Use of genomic assay and ketogenic compounds for treatment of reduced cognitive function

专利摘要:

公开号:ES2556534T9
申请号:ES13167178.6T
申请日:2008-07-31
公开日:2016-07-06
发明作者:Samuel T. Henderson
申请人:Accera Inc；
IPC主号:

专利说明:

image 1
DESCRIPTION
Use of genomic assay and ketogenic compounds for the treatment of reduced cognitive function 5 Field of the invention
The present invention relates to patient selection methods for a treatment for reduced cognitive function, in which the treatment comprises the administration to the patient of at least one compound capable of raising ketone concentrations in the body in an amount effective for the treatment of reduced cognitive function. Reduced cognitive function is associated with Age-Associated Memory Alteration (AAMI), Alzheimer's Disease (AD), Parkinson's Disease, Friedreich's Ataxia (FRDA), GLUT1-Deficient Epilepsy, Leprechaunism, and Rabson's Syndrome. Mendenhall, dementia due to coronary artery bypass graft (CABG), memory loss induced by anesthesia, Huntington's disease, and many others. 15 Background of the invention
Alzheimer disease
Alzheimer's disease (AD) is a progressive neurodegenerative disorder that primarily affects older people. In 1984, Blass and Zemcov (Blass and Zemcov 1984) proposed that AD resulted from a decrease in metabolic rate in subpopulations of cholinergic neurons. Measures of cerebral glucose metabolism indicate that glucose metabolism is reduced by 20-40% in AD resulting in critically low levels of ATP.
25 Some attempts to compensate for the reduction in brain metabolic rates in AD have found some successes. The increase in serum ketone levels in the body in patients with AD raises cognitive scores (Reger, Henderson et al., 2004) and USP. Parkinson's disease (PD)
Parkinson's disease (PD) is a progressive neurodegenerative disorder that is the second most common neurodegenerative disease after Alzheimer's disease. The prevalence of calculated PD is 0.3 percent in the general population of the United States and a prevalence of 4 to 5 percent in individuals over 85 years. PD is characterized by motor abnormalities, which include tremor, muscle stiffness, lack of
35 voluntary movements, and postural instability. A main neuropathological characteristic of PD is the loss of dopaminergic neurons in the compact pars of the black substance (SNpc) and the presence of eonsinophilic intracytoplasmic inclusions (Lewy bodies) in residual dopaminergic neurons.
Therefore, there is a need for more effective treatments for PD and in particular treatments that are neuroprotective.
Although the cause of sporadic PD is uncertain, several lines of evidence suggest that some defects in oxidative phosphorylation may contribute to its pathogenesis. For example, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) blocks complex I (NADH-ubiquinone oxidoreductase) of the electron transport chain
45 mitochondrial, and causes the loss of dopaminergic neurons and the usual symptoms of PD. Reduction of complex I activity has also been reported in tissues with PD. This defect is not only limited to the brain but has also been found in platelets of patients with PD.
D-beta-hydroxybutyrate (BHB) is a ketone body produced by hepatocytes and, to a lesser extent, by astrocytes. BHB acts as an alternative energy source in the brain when the glucose supply is limited such as during the fasting period. BHB has been found to protect against the inhibition of MPTP-related complex I, increasing oxidative phosphorylation (Tieu, 2003). Friedreich's ataxia (FRDA)
55 FRDA is a recessive disease characterized by progressive ataxia, hypertrophic cardiomyopathy, early onset of insulin-resistant diabetes, disability, and premature death. FRDA is a genetic disorder caused by a deficiency of frataxin, a mitochondrial protein of 210 amino acids encoded by the nuclear genome. The low levels of the protein are due to the expansion of an intronic repetition of GAA, which leads to the decrease in mRNA levels. Patients with FRDA show a decrease in mitochondrial aconite enzyme activity. Aconite is responsible for the conversion of citrate to isocitrate, the first stage of the Krebs cycle (also known as the citric acid cycle or TCA). It is believed that frataxin deficiency in human patients leads mainly to defects in the TCA cycle.
65 Recent work shows that the increase in ketone bodies in the blood, a normal response to fasting, can increase mitochondrial levels of citrate and isocitrate, thereby overcoming the blockage of aconites found in FRDA. A therapy based on ketone bodies could provide an effective treatment for this group of patients.
image2 GLUT1 deficient epilepsy
5 GLUT1-deficient epilepsy is characterized by childhood seizures, developmental delay, and acquired microcephaly with mental retardation. GLUT1-deficient epilepsy results in several types of GLUT1 gene mutations. Glucose transporter 1 (GLUT1) is the main protein responsible for transporting glucose from the bloodstream to the brain. Under conventional diet conditions, the brain depends almost entirely on blood glucose for energy. However, in some circumstances, such as fasting, ketone bodies can provide a source of energy other than glucose. Ketone bodies are not based on GLUT1 for transport in the brain and therefore can provide energy in GLUT1-deficient syndrome. Therefore, ketone body therapy can become a practical method for a lifelong treatment of these patients.
fifteen Leprechaunism and Rabson-Mendenhall Syndrome
Leprechaunism and Rabson-Mendenhall syndrome are rare diseases characterized by insulin resistance, persistent hyperglycemia and growth retardation. Subjects rarely survive more than 20 years of age. These syndromes result from mutations in the insulin receptor gene, which decreases the affinity of the receptors towards insulin. The current treatment consists of the administration of increasing doses of insulin (up to several thousand units per day). This treatment provides only weak results due to poor insulin binding to its receptor. Ketone bodies have been shown to mimic the effects of insulin stimulation of the multienzyme PDH complex, thereby increasing the metabolite levels of the cycle
25 TCA of Krebs, increasing energy production in the form of ATP, and increasing metabolic efficiency. A diet high in ketones, or ketogenic, can show that it is an effective treatment for these conditions. Alteration of Memory Associated with Age
Aging causes deterioration of various aspects of physiology in normal adults, including memory performance. Practicing physicians have long recognized such age-related decreases in cognitive performance. The alteration of memory performance in older people has been detected in several conventional memory trials, including the Wechsler Memory Scale (WMS) and the Immediate and Delayed Visual Reproduction Test (Trahan et al. Neuropsychology, 1988
35 19 (3) p. 173-89), the Auditory and Verbal Learning Trial of Rey (RAVLT) (Ivnik, RJ et al. Psychological Assessment: A Journal of Consulting and Clinical Psychology, 1990 (2): p. 304-312) and others (for a review see Larrabee and Crook, Int. Psychogeriatr, 1994 6 (1): p. 95-104. Other diseases and syndromes
A large number of other diseases and syndromes are associated with decreased metabolism. Such conditions include dementia due to coronary artery bypass graft (CABG), memory loss induced by anesthesia, Huntington's disease and many others. It is clear that a metabolic intervention can help people suffering from such conditions.
Therefore, in the art there is a need to develop compositions and methods for the treatment and / or prevention of cognitive impairment, in particular in aging or geriatric mammals such as humans.
Patent document US6835750 describes methods and compositions for treating or preventing, the appearance of senile dementia of the Alzheimer type, there were conditions that arise from the reduction of neuronal metabolism and that lead to a reduction of cognitive function. The administration of triglycerides or fatty acids with chain lengths between 5 and 12 is disclosed to said patient at a level to produce an improvement in cognitive ability.
55 Patent documents WO2004 / 077938 and US2006 / 189545 refer to therapeutic agents for the treatment of Alzheimer's disease and other diseases associated with the reduction of neuronal metabolism that includes Parkinson's disease, Huntington's disease, and epilepsy. The therapeutic agents are esterified saccharides.
Various publications are mentioned throughout the specification, including patents, published applications, technical articles and academic articles. A partial list of those patents and applications referred to herein include, for example, USSN 60 / 953.074, "Genomic testing in Alzheimer's disease and other diseases associated with reduced neuronal metabolism", filed on 31 July of
65 2007; USSN 60 / 917,886, "Inhibitors of Acetyl-CoA Carboxylase for Treatment of Hypometabolism", filed May 14, 2007; USSN 11 / 123,706, "Method for Reducing Levels of Disease Associated Proteins", filed May 3, 2005; USSN 11 / 424,429, "Method To Reduce Oxidative Damage And Improve Mitochondrial Efficiency", filed June 15, 2006; USSN 10 / 546,976, "Novel-Chemical Entities and Methods for their Use in Treatment of Metabolic Disorders", filed on August 25, 2005; USSN 09 / 845,741, filed May 1, 2001; USSN 10 / 152,147, presented on
image3
5 12/28/2004, currently USPN document 6,835,750; USSN 11 / 021,920, filed on December 22, 2004; USSN 11 / 331,673, filed on January 13, 2006; USSN 11 / 611,114, filed December 14, 2006; and USSN 11 / 771,431, filed June 29, 2007. Summary of the invention
In one embodiment, the invention comprises a method for selecting a patient for the treatment of reduced cognitive function related to the disease caused by reduction of the neuronal metabolism associated with Alzheimer's disease (AD), a method comprising:
15 a. select a patient who has reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease (AD);
b. determine in the patient the presence of at least one of the specific genotypes selected from the group consisting of:
i. homozygosis for cytosine of rs2738447 of Low Density Lipoprotein Receptor (LDLR) in a relevant portion shown by SEQ ID NO: 24,
ii. homozygosis for guanine of LDLR rs7259278 in a relevant portion shown by SEQ ID NO: 25, and
iii. homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15;
and 25
C. selecting a patient who has at least one of the specific genotypes in (b) for treatment, in which the treatment comprises the administration to the patient of at least one medium chain triglyceride (MCT) in an amount effective for treatment or prevention of the reduction of cognitive function related to the disease by reduction of neuronal metabolism associated with Alzheimer's disease.
The patient may also have at least one of the specific genotypes that include: heterozygous for C / T for rs2551101 Insulin Degradant Enzyme (IDE) in a relevant portion shown by SEQ ID NO: 3, absence of homozygosis for C / C of rs2551101 of IDE in a relevant portion shown by SEQ ID NO: 3, heterozygosis for A / C of Apolipoprotein E (APOE) rs405509 in a relevant portion shown by SEQ ID 35: 21, heterozygosis for G / A of rs1803274 of Butyrylcholine esterase (BUCHE) in a relevant portion shown by SEQ ID NO: 18, homozygosis for precursor adenine rs2229765 of Insulin-like Growth of Factor Receptor (IGF1R) in a relevant portion shown by SEQ ID NO: 6 , homozygosis for thymine of rs1143627 of Interleukin-1 beta (IL1B) in a relevant portion shown by SEQ ID NO: 9, homozygosis for cytosine of rs16944 of IL1B in a relevant portion shown by SEQ ID NO: 10, homozygosis for itos2738447 cytosine of the Low Density Lipoprotein Receptor (LDLR) in a relevant portion shown by SEQ ID NO: 24, homozygosis for guanine of rs7259278 of LDLR in a relevant portion shown by SEQ ID NO: 25, and homozygosis for LDLR rs1799898 cytosine in a relevant portion shown by SEQ ID NO: 15. The method comprises selecting a patient having the specific genotypes for treatment, wherein the treatment comprises the administration to the patient of at least one medium chain triglyceride. in an amount
45 effective for the treatment or prevention of reduced cognitive function caused by the reduction of neuronal metabolism.
In another embodiment, the present invention includes a medium chain triglyceride for use in a method for treatment or prevention of reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease in a patient, in which the Treatment method comprises selecting the patient according to the method of claim 1.
This method includes the steps of selecting a patient who has reduced neuronal metabolism associated with Alzheimer's disease according to the method of claim 1. The patient may also have one of the specific genotypes that include: heterozygous for C / T for rs2551101 of Insulin Degradant Enzyme (IDE) in a relevant portion shown by SEQ ID NO: 3, absence of homozygosis for C / C of rs2551101 of IDE in a relevant portion shown by SEQ ID NO: 3, heterozygous for A / C of Apolipoprotein E (APOE) rs405509 in a relevant portion shown by SEQ ID NO: 21, heterozygous for G / A of rs1803274 of Butyrylcholine esterase (BUCHE) in a relevant portion shown by SEQ ID NO: 18, homozygosis for rs2229765 adenine of the Insulin-like Growth Factor Receptor Precursor in a relevant portion shown by SEQ ID NO: 6, homozygous for thymine of rs1143627 of Interleukin-1 b eta (IL1B) in a relevant portion shown by SEQ ID NO: 9, homozygosis for cytosine of rs16944 of IL1B in a relevant portion shown by SEQ ID NO: 10, homozygosis for cytosine of rs2738447 of the Low Density Lipoprotein Receptor ( LDLR) in a relevant portion shown by SEQ ID NO: 24, homozygosis for guanine from
65 rs7259278 of LDLR in a relevant portion shown by SEQ ID NO: 25, and homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15.
image4 Brief description of the figures
Fig. 1 demonstrates the interaction between IDE and APOE polymorphisms in the change of ADAS-Cog induced by the Treatment. Detailed description of the invention
The new view of the present invention is that some particular polymorphisms may be useful for selecting patients for treatment of reduced cognitive function caused by reduction of neuronal metabolism, in which the treatment comprises the administration of at least one compound capable of elevating ketone body concentrations. Some polymorphisms in particular are associated with "responding patients", that is, populations of patients in which the methods of treatment include the administration of compounds capable of increasing the concentration of ketone bodies are associated with efficacy. In the
This disclosure also includes methods for treating patients who have reduced cognitive functions that include testing the patient for particular polymorphisms and selecting a patient for treatment based on the presence of the particular polymorphism.
In one embodiment, the invention comprises a method for selecting a patient for treatment of reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease (AD), a method comprising:
to. select a patient who has reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease (AD);
25 b. determine in the patient the presence of at least one of the specific genotypes selected from the group consisting of:
i. homozygosis for cytosine of rs2738447 of Low Density Lipoprotein Receptor (LDLR) in a relevant portion shown by SEQ ID NO: 24,
ii. homozygosis for guanine of LDLR rs7259278 in a relevant portion shown by SEQ ID NO: 25, and
iii. homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15; Y
C. select a patient who has at least one of the specific genotypes in (b) for treatment, in which
The treatment comprises the administration to the patient of at least one medium chain triglyceride (MCT) in an amount effective for the treatment or prevention of the reduction of cognitive function related to the disease by reduction of neuronal metabolism associated with the disease of Alzheimer's
The patient may also have at least one of the specific genotypes that include: heterozygous for C / T for rs2551101 Insulin Degradant Enzyme (IDE) in a relevant portion shown by SEQ ID NO: 3, absence of homozygosis for C / C of rs2551101 of IDE in a relevant portion shown by SEQ ID NO: 3, heterozygosis for A / C of Apolipoprotein E (APOE) rs405509 in a relevant portion shown by SEQ ID NO: 21, heterozygous for G / A of rs1803274 of Butyrylcholine esterase (BUCHE) in a relevant portion shown by SEQ ID NO: 18, homozygosis for rs2229765 adenine of the Growth Factor Receptor Precursor
45 of the Insulin type in a relevant portion shown by SEQ ID NO: 6, homozygous for thymine of rs1143627 of Interleukin-1 beta (IL1B) in a relevant portion shown by SEQ ID NO: 9, homozygous for cytosine of rs16944 of IL1B in a relevant portion shown by SEQ ID NO: 10, homozygosis for cytosine of rs2738447 of the Low Density Lipoprotein Receptor (LDLR) in a relevant portion shown by SEQ ID NO: 24, homozygosis for guanine of rs7259278 of LDLR in a relevant portion shown by SEQ ID NO: 25, and homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15. The patient having at least one of the specific genotypes is selected for treatment, in that the treatment comprises the administration to the patient of at least one medium chain triglyceride (MCT) in an amount effective for the treatment or prevention of reduced cognitive function caused by the network uction of neuronal metabolism.
In another embodiment, the present invention includes a medium chain triglyceride for use in a method for treatment or prevention of reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease in a patient, in which The method of treatment comprises selecting the patient according to the method of claim 1.
This method may include the steps of selecting a patient who has, or is at risk of reduced cognitive function caused by reduction of neuronal metabolism and determining in the patient the presence of homozygosis for rs2738447 cytosine of the Low Density Lipoprotein Receptor (LDLR ) in a relevant portion shown by SEQ ID NO: 24, homozygosis for guanine of rs7259278 of LDLR in a relevant portion 65 shown by SEQ ID NO: 25 or homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEC ID No.: 15. The patient may also have at least one of the specific genotypes that
image5
include heterozygous for C / T for rs2551101 of Insulin Degradant Enzyme (IDE) in a relevant portion shown by SEQ ID NO: 3, absence of homozygosis for C / C of rs2551101 of IDE in a relevant portion shown by SEQ ID NO. : 3, heterozygosis for A / C of Apolipoprotein E (APOE) rs405509 in a relevant portion shown by SEQ ID NO: 21, heterozygosis for G / A of rs1803274 of Butyrylcholine esterase (BUCHE)
5 in a relevant portion shown by SEQ ID NO: 18, homozygous for rs2229765 adenine of the Growth Factor Receptor Precursor of the Insulin type in a relevant portion shown by SEQ ID NO: 6, homozygous for thymine of rs1143627 of the Interleukin-1 beta (IL1B) in a relevant portion shown by SEQ ID NO: 9, homozygosis for cytosine of rs16944 of IL1B in a relevant portion shown by SEQ ID NO: 10, homozygosis for cytosine of rs2738447 of Lipoprotein Receptor of Low density (LDLR) in a relevant portion shown by SEQ ID NO: 24, homozygosis for guanine of rs7259278 of LDLR in a relevant portion shown by SEQ ID NO: 25, and homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15. The method may additionally include administration to the patient, which has at least one of the specific genotypes, of at least one MCT in an amount effective for the treatment. Treatment or prevention of reduced cognitive function caused by reduced neuronal metabolism.
The patient test for a specific genotype can be performed with methods normally used in the art. Specifically, based on the genotype of interest in particular, the choice of appropriate primers is routine for an expert. There are numerous online tools for the guideline of a primer design, such as, for example, the Primer3 algorithm (v. 0.4.0) that allows choosing the appropriate primers to detect a directed DNA sequence, available at <frodo.wi .mit.edu>.
Once the primers are selected, DNA extraction can be performed by extracting genomic DNA from EDTA anticoagulated venous blood, which can be achieved with methods known in the art such as the QIA-amp Blood-DNA mini-reagent set ( Qiagen) according to the manufacturer's instructions. For
To detect specific polymorphisms, sets of primers appropriately designed to amplify regions containing the polymorphism of interest can be used, using methods known in the art. Genotyping can be determined through direct sequencing of PCR products using products known in the art such as the ABI PRISM BigDye Fast Sequencing Reaction Kit and ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA , USES).
In addition, the genotype presents heterozygous (C / T) for SNP rs2251101 of IDE also known as IDE_7 of Insulin Degrading Enzyme (IDE). In another embodiment, the genotype comprises absence of homozygosis for C / C for SNP rs2251101 also known as IDE_7 of Insulin Degrading Enzyme (IDE). IDE (HGNC Symbol ID). This gene is a member of the human CCDS set: CCDS7421. Genetic ID of the Set:
35 ENSG00000119912. Genome Position: This gene can be found on Chromosome 10 at position 94,201,421-94,323,813. The beginning of this gene is located in Contig AL356128.27.1.191935. Description: Insulin degrading enzyme (EC 3.4.24.56) (Insulisin) (Insulinase) (Insulin protease). Source: Uniprot / SWISSPROT P14735. SEQ ID NO: 3 shows a selected portion of this gene that identifies SNP polymorphisms rs2251101.
Additionally, the genotype may comprise homozygosis for A for rs2229765 of insulin-like growth factor 1 (IGFR-1). The IGF1R (HGNC Symbol ID). This gene is a member of the human CCDS set: CCDS10378. Genetic ID of the Set: ENSG00000140443. Genome Position: This gene can be found on Chromosome 15 at position 97,010,302-97,319,034. The beginning of this gene is located in Contig
45 AC118658.4.1.168727. Description of the Insulin-like growth factor 1 receptor precursor (EC 2.7.10.1) (Insulin-like growth factor I receptor) (IGF-I receptor) (CD221 antigen) [Contains: alpha receptor chain of Insulin-like growth factor 1; Insulin-like growth factor 1 receptor beta chain]. Source: Uniprot / SWISS-PROT P08069. SEQ ID NO: 6 shows a selected portion of this gene that identifies SNP polymorphisms rs2229765.
Additionally, the genotype may present homozygosis for T in rs1143627 of IL1B. Additionally, the genotype presents homozygosis for C in rs16944 of IL1B. IL1B (HGNC Symbol ID). This gene is a member of the human CCDS set, CCDS2102 with the Genetic ID of the ENSG00000125538 Set. This gene can be found on Chromosome 2 at position 113,303,808-113,310,827. The beginning of this gene is located in Contig
55 AC079753.7.1.154214. The description is Interleukin-1 beta precursor (IL-1 beta) (Cataboline). Source: Uniprot / SWISSPROT P01584. Rs1143627 is a C / T substitution and SEQ ID NO: 9 shows a selected portion of this gene that identifies the placement of this SNP. rs16944 (dbSNP125) is a substitution of A / G and SEQ ID NO: 10 shows a selected portion of this gene that identifies polymorphisms of this SNP.
Additionally, the genotype has homozygosis for C in rs2738447 of LDLR. This gene is a member of the human CCDS set: CCDS 12254 with a genetic ID of the set ensg00000130164. This gene can be found on Chromosome 19 at position 11,061,155-11,103,838 and the beginning of this gene is located in Contig AC011485.6.1.128618. The description is a precursor to the low density lipoprotein receptor (LDL receptor). Source: Uniprot / SWISSPROT P01130. SEQ ID NO: 24 shows a selected portion of this gene that
65 identifies polymorphisms of this SNP. Additionally, the genotype has homozygosis for G in rs7259278 of LDLR. This gene is a member of the human CCDS set: CCDS12254 with a genetic ID of the set ensg00000130164. This gene can be found on Chromosome 19 at position 11,061,155-11,103,838 and the beginning of this gene is located in Contig AC011485.6.1.128618. The description is a precursor to the low density lipoprotein receptor (LDL receptor). Source: Uniprot / SWISSPROT P01130. SEQ ID NO: 25 shows a selected portion of this gene that
image6
5 identifies polymorphisms of this SNP.
Additionally, the genotype has homozygosis for C in rs1799898 of LDLR. LDLR (HGNC Symbol ID). This gene is a member of the human CCDS set: CCDS12254 with a genetic ID of the set ensg00000130164. This gene can be found on Chromosome 19 at position 11,061,155-11,103,838 and the beginning of this gene is located in Contig AC011485.6.1.128618. The description is a precursor to the low density lipoprotein receptor (LDL receptor). Source: Uni-prot / SWISSPROT P01130. SEQ ID NO: 15 shows a selected portion of this gene that identifies SNP polymorphisms rs1799898.
Additionally, the genotype may present heterozygous for G / A for the rs1803274 variant of K of the
15 Butyrylcholine esterase (BUCHE). BCHE (HGNC Symbol ID). This gene is a member of the human CCDS CCDS3198 set. The Genetic ID of the Set is ENS00000114200. This gene can be found in Chromosome3 at position 166,973,387-167,037,944. The beginning of this gene is located in Contig AC009811.14.1.171083. Cholinesterase precursor (EC 3.1.1.8) (Acylcholine acylhydrolase) (Choline esterase II) (Butyrylcholine esterase) (Pseudocholinesterase). Source: Uniprot / SWISSPROT P06276. SEQ ID NO: 18 shows a selected portion of this gene that identifies SNP polymorphisms rs1803274.
The genotype may present heterozygosis for A / C of the rs405509 variant of apolipoprotein E promoter (APOE). Rs405509 is the -219 variant and has an A / C allele. APOE (HGNC Symbol ID). This gene is a member of the human CCDS set: CCDS12647. The Genetic ID of the Set is ENSG00000130203. This
25 gene can be found on Chromosome 19 at position 50,100,879-50,104,489. The beginning of this gene is located in Contig AC011481.4.1.107567. Apolipoprotein E (Apo-E) precursor. Source: Uniprot / SWISSPROT P02649. SEQ ID NO: 21 shows a selected portion of this gene that identifies SNP polymorphisms rs405509.
As used herein, neuronal metabolism reduction refers to all possible mechanisms that could lead to a reduction in neuronal metabolism. Such mechanisms include, but are not limited to, mitochondrial dysfunction, free radical attack, generation of reactive oxygen species (ROS), ROS-induced neuronal apoptosis, defective glucose or glycolysis transport, imbalance in the ionic potential of the membrane, dysfunction. in the flow of calcium, and the like. The patient has or is at risk of developing reduced cognitive function related to the disease caused by reduction of the associated neuronal metabolism
35 to Alzheimer's disease (AD).
In accordance with the present invention, elevated blood ketone levels will provide a source of energy to brain cells that have compromised glucose metabolism, which leads to increased cognitive function performance. As used herein, "patient" refers to any mammal, including humans that may benefit from the treatment of disease and conditions that result from the reduction of neuronal metabolism.
The compound capable of increasing the concentration of ketone bodies in a mammalian organism are "medium chain triglycerides" or "MCT", referring to any glycerol molecule linked by
45 ester to three fatty acid molecules, each fatty acid molecule having a carbon chain of 5-12 carbons. The MCT can be represented with the following general formula:
image7
wherein R1, R2 and R3 are fatty acids having 5-12 carbons in the main carbon chain esterified to the main glycerol chain. The structured lipids of the present invention can be prepared by any productive process in the art, such as direct esterification, transposition, fractionation, transesterification, or the like. For example, lipids can be prepared by transposing a vegetable oil such as coconut oil. The length and distribution of the chain length may vary depending on the
55 oil used as a source. For example, MCTs that contain 1-10% of C6, 30-60% of C8, 30-60% of C10, 1-10% of C10 are normally derived from palm and coconut oils. MCTs containing more than about 95% C8 in R1, R2 and R3 can be prepared by semisynthetic esterification of octanoic acid in glycerin. Such MCTs behave in the same way and are included within the term MCT as used herein.
MCTs consist of fatty acids with a chain length between 5-12 carbons and have been extensively investigated. MCTs are metabolically different from the more common Long Chain Triglycerides (LCT). In particular, when compared to LCTs, MCTs digest more easily to release medium chain fatty acids (MCFAs) that exhibit increased portal absorption rates, and feed forced oxidation. MCFAs have much lower melting points than long chain fatty acids (LCFA), and therefore MCFAs and corresponding MCTs are liquid at room temperature. MCFAs are smaller and
image8
5 more ionized at physiological pH compared to LCFA, and therefore MCFAs are much more soluble in aqueous solutions. The small size and decreased hydrophobia of MCTs increase the rate of digestion and relative absorption with respect to TBI.
When ingested, MCTs are professed first by lipases, which extend the fatty acid chains of the main glycerol chain. Some lipases in the pre-duodenum preferentially hydrolyze the MCTs with respect to the LCTs and the released MCFAs are then absorbed in part directly by the stomach mucosa. MCFAs that are not absorbed in the stomach are absorbed directly into the portal vein and are not packaged in lipoproteins. LCFAs derived from fat from a normal diet are re-esterified in LCT and packaged in chylomicrons for transport in lymph. This greatly slows the metabolism of TBIs with respect to
15 MCT. Since blood performs transport much faster than lymph, MCFAs quickly reach the liver.
In the liver, the MCFA experimental forced oxidation. In the fed state, LCFAs experience little oxidation in the liver, mainly due to the inhibitory effects from malonyl-CoA. When conditions favor fat storage, malonyl-CoA is produced as an intermediate compound in lipogenesis. Malonyl-CoA allosterically inhibits carnitine palmitoyltransferase I, and thus inhibits the transport of LCFA in the mitochondria. This feedback mechanism avoids useless cycles of lipolysis and lipogenesis. MCFAs are, to a large extent, immune to the regulations that control the oxidation of LCFA. MCFAs enter the mitochondrial without the use of carnitine palmitoyltransferase I, therefore MCFAs divert
25 this regulatory stage and oxidize independently of the metabolic state of the organism. Importantly since MCFAs enter the liver rapidly and oxidize rapidly, large amounts of ketone bodies are easily produced from MCFAs and a large oral dose of MCT (approximately 20 ml) will result in sustained hypercetonemia. The inventor's new vision is that MCTs can be administered outside the context of a ketogenic diet. Therefore, in the present invention carbohydrates can be consumed at the same time as MCTs.
"Effective amount" refers to an amount of a compound, material, or composition, as described herein that is effective in achieving a particular biological result. The effectiveness of the treatment of the aforementioned conditions can be assessed by improving results from at least
35 a neuropsychological trial. These neuropsychological tests are known in the art and include Global Clinical Change Impression (CGIC), Auditory Learning Test and Verbal de Rey (RAVLT), Name and Surname Association (FLN) Test, Telephone Dialing Test (DTT), Clinical Self-Classification Memory Evaluation Scale (MAC-S), Digit and Symbol Coding (SDC), SDC Delayed Recall Task (DRT), Divided Attention Test (DAT), Visual Sequence Comparison (VSC) , Double DAT Task (Double DAT), Mini-Mental State Examination (MMSE), and Geriatric Depression Scale (GDS), among others.
The term "cognitive function" refers to the special, normal, or appropriate physiological activity of the brain, which includes, without limitation, at least one of the following: mental stability, memory / recall abilities, problem solving abilities, reasoning, thinking abilities, abilities of
45 judgment, ability to learn, perception, intuition, attention, and awareness. "Increased cognitive function" or "enhanced cognitive function" refers to any improvement in the special, normal, or appropriate physiological activity of the brain, which includes, without limitation, at least one of the following: mental stability, memory abilities / memory, problem solving abilities, reasoning abilities, thinking abilities, judgment abilities, ability to learn, perception, intuition, attention, and awareness, as measured by any suitable means in the art. "Reduced cognitive function" or "altered cognitive function" refers to any decrease in the special, normal, or appropriate physiological activity of the brain.
Administration can be performed as necessary or as desired, for example, once a month, once a week, daily, or more than once a day. Similarly, administration can be done every two
55 days, week or month, every three days, week or month, every four days week or month, and the like. Administration can be done multiple times a day. When used as a supplement for ordinary dietary requirements, the composition can be administered directly to the patient or otherwise brought into contact with or mixed with the food or meal daily.
Administration can also be performed on a regular basis, for example, as part of a patient's treatment regimen. A treatment regimen may comprise causing regular ingestion by the patient of a composition of the invention in an amount effective to increase cognitive function, memory and behavior in the patient. Regular ingestion may be once a day, or two, three, four, or more times a day, on a daily or weekly basis. Similarly, regular administration may be every two days or weeks, every 65 three days or weeks, every four days or weeks, every five days or weeks, or every six days or weeks, and in such a regime, the Administration can be performed multiple times a day. The objective of the administration


Regular is to provide the patient with an optimal dose of a composition of the invention, as is exemplified herein.
The compositions provided herein, in one embodiment, are intended for
5 "long-term" consumption, sometimes referred to herein as "extended" periods of time. "Long-term" administration as used herein generally refers to periods exceeding one month. Some periods of more than two, three, or four months comprise an embodiment of the present invention. Also included are embodiments that comprise longer periods that include more than 5, 6, 7, 8, 9, or 10 months. Also included are periods that exceed 11 months or 1 year. This document also covers longer term uses that extend over periods longer than 1, 2, 3 or more years. "Regular base" as used herein refers to a dosage, at least weekly with or consumption of the compositions. The most frequent dosage or consumption is included, such as twice or three times a week. Also included are regimes that include at least once a day consumption. The skilled artisan observed that the level of ketone bodies in blood, or a specific ketone body,
15 achieved can be a valuable measure of the dosage frequency. Any frequency, regardless of whether it is used by way of example expressly herein, which allows the maintenance of a blood level of the compound within acceptable ranges may be considered useful herein. The person skilled in the art will observe that the dosage frequency will be a function of the composition being consumed or administered, and some compositions may need more or less frequent administration to maintain a desired level of the compound measured in blood (for example, a ketone body).
In one embodiment, the method comprises the use of MCT in which R1, R2, and R3 are fatty acids containing a main chain of six carbon atoms (tri-C6: 0). Tri-C6: 0 MCTs are absorbed very rapidly in the gastrointestinal tract in a number of animal model systems. The high absorption rate resulted in rapid liver perfusion, and a potent ketogenic response. In another embodiment, the method comprises the use of MCTs in which R1, R2, and R3 are fatty acids containing a main chain of eight carbon atoms (tri-C8: 0). In another embodiment, the method comprises the use of MCT in which R1, R2, and R3 are fatty acids containing a main chain of ten carbon atoms (tri-C10: 0). In another embodiment, the method comprises the use of MCT in which R1, R2, and R3 are a mixture of C8: 0 and C10: 0 fatty acids. In another embodiment, the method comprises the use of MCT in which R1, R2, and R3 are a mixture of C6: 0, C8: 0, C10: 0, and C12: 0 fatty acids. In another embodiment, more than 95% of R1, R2, and R3 carbon chains of the MCTs are 8 carbon atoms in length. Further in another embodiment, the carbon chains R1, R2, and R3 are chains of 6 carbon atoms or 10 carbon atoms. In another embodiment, 50% of the carbon chains R1, R2, and
R3 of the MCTs have a length of 8 carbons and about 50% of the carbon chains R1, R2, and R3 of the MCTs have a length of about 10 carbon atoms. Additionally, the use of MCT can be increased by emulsification. Lipid emulsification increase the surface area for action by lipases, resulting in faster hydrolysis and release of MCFA. Those skilled in the art are well aware of some methods for emulsifying these triglycerides.
In one embodiment, the method comprises the use of MCFA with a chain length of 6, 8, 10 and 12 carbon atoms or mixtures of those mentioned above.
Some therapeutically effective amounts of therapeutic agents may be any candidate dose.
45 sufficient to achieve the desired effect and depend, in part, on the severity and stage of the condition, the size and condition of the patient, as well as other factors immediately known to those skilled in the art. Dosages can be administered in a single dose, or as several doses, for example, divided over several weeks, as discussed anywhere in this document.
In one embodiment, the ketogenic compounds are administered orally. In another embodiment, the ketogenic compounds are administered intravenously. Those skilled in the art are well aware of the oral administration of MCT and other preparations of intravenous MCT ketogenic compound and other solutions of ketogenic compound.
In one embodiment, oral and / or intravenous administration of a composition comprising at least one compound capable of increasing ketone body concentrations (MCT) results in hypercetonemia. Hypercetonemia, in one embodiment, results in ketone bodies that are used for energy in the brain even in the presence of glucose. Additionally, hypercetonemia results in a substantial (39%) increase in cerebral blood flow (Hasselbalch, SG, et al., Changes in cerebral blood flow and carbohydrate metabolism during acute hyperketonemia, Am J Physiol, 1996, 270: E746- 51). Hypercetonemia has been reported to reduce cognitive dysfunction associated with systemic hypoglycemia in normal humans (Veneman, T., et al., Effect of hyperketonemia and hyperlacticacidemia on symptoms, cognitive dysfunction, and counterregulatory hormone responses during hypoglycemia in normal humans, Diabetes , 1994, 43: 1311-7). Please note that systemic hypoglycemia is different from local defects in glucose metabolism.
65 that occur in any cognitive decline associated with the disease or with age, such as AD, AAMI, and the like.
image9
Also disclosed are compositions comprising at least one compound that is capable of raising ketone body concentrations. Such compounds are also collectively referred to as ketone body precursor compounds or ketogenic compounds. Such compounds are MCT. Also described herein, but not part of the claimed invention, MCFA, and prodrugs, metabolic precursors, etc., of ketone bodies. For example, the compound capable of raising the concentrations of ketone bodies in the organism includes one or more prodrugs, which can be converted metabolically into the compounds object by the receptor host. As used herein, a prodrug is a compound that exhibits pharmacological activity after undergoing a chemical transformation in the organism. A prodrug can also be called a metabolic precursor if the conversion of the prodrug directly results in the formation of a ketone body. First, MCT and MCFA must be oxidized to acetyl-CoA, and then undergo several stages before their synthesis in ketone bodies. The class of precursor compounds of precursor ketone bodies includes, the compounds described hereinafter. The precursor compounds of ketone bodies, in one embodiment, are administered in
15 a dosage necessary to increase ketone bodies in blood to a level necessary to treat and / or prevent the onset of any cognitive decline associated with the disease or with age, such as AD, AAMI, and the like. Some appropriate dosages of all these compounds can be determined by one skilled in the art.
20 A wide variety of prodrug formulations are known in the art. For example, the prodrug bonds can be hydrolyzed, such as esters or anhydrides, they can be enzymatically biodegraded, such as amides.
Some precursor compounds of ketone bodies, for example compounds capable of raising the
25 concentrations of ketone bodies, suitable for use with the present invention include any compound that is capable of directly raising the concentrations of ketone bodies in a mammalian organism, for example, a patient, and can be determined by one skilled in the art. These compounds may mimic the effect of increased fatty acid oxidation and include, but are not limited to ketone bodies, D-betahydroxybutyrate and acetoacetate, and metabolic precursors thereof. The metabolic precursor expression, used
In the present embodiment, it may refer to compounds comprising moieties of 1,3 butanediol, acetoacetyl or D-beta-hydroxybutyrate such as acetoacetyl-1-1,3-butanediol, acetoacetyl-D-beta-hydroxybutyrate, and acetoacetylglycerol. Some esters of any such compound with monohydric, dihydric or trihydric alcohols are also included in another additional embodiment. Some metabolic precursors also include polyester from D-beta-hydroxybutyrate, and esters of D-beta-hydroxybutyrate acetoacetate. Some D polyesters
Beta-hydroxybutyrate includes oligomers of this polymer designed to be easily digestible and / or metabolic by mammals. These preferably have a length of 2 to 100 repetitions, generally a length of 2 to 20 repetitions, and most conveniently a length of 3 to 10 repetitions. Below are some examples of poly-D-beta-hydroxybutyrate or terminally oxidized poly-Dbeta-hydroxybutyrate esters that can be used as precursors of ketone bodies:
image10
image11
In each case, n is selected so that the polymer or oligomer is easily metabolized upon administration to a human or mammalian organism to provide high levels of ketone bodies in blood. The 5 values of n are whole numbers from 0 to 1,000, more preferably from 0 to 200, still more preferably from 1 to 50, most preferably from 1 to 20, being particularly convenient from 3 to 5. In each case m it is an integer of 1 or higher, a complex thereof with one or more cations or a salt thereof for use in therapy or nutrition. Some examples of usual physiological cations and salts are described herein, and additionally include sodium, potassium, magnesium, calcium, each balanced with a counterion
10 physiological forming saline complex, L-lysine, L-arginine, methyl glucamine, and others known to those skilled in the art.
The definition of a ketone body precursor compound also includes several other ketone body precursor compounds useful for the treatment of neuronal metabolism reduction; including 15 esters of polyhydric alcohols, esters of 3-hydroxy acid and glycerol esters, as described in more detail hereafter. As used herein, "derivative" refers to a compound or portion of a compound that is derived or theoretically derived from a precursor compound; the expression "hydroxyl group" is represented by the formula -OH; the term "alkoxy group" is represented by the formula --OR, in which R may be an alkyl group, which includes a lower alkyl group, optionally substituted with an alkenyl, alkynyl, aryl, aralkyl, cycloalkyl, halogenated alkyl group , or heterocycloalkyl, as defined below; the term "ester" is represented by the formula -OC (O) R, wherein R may be an alkyl, alkenyl, alkynyl, aryl, aralkyl, cycloalkyl, halogenated alkyl, or heterocycloalkyl group, as defined below; the term "alkyl group" is defined as a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, pentyl , hexyl, heptyl, octyl, decyl, tetradecyl, hexadecyl, eicosyl, tetracosyl and the like. A "lower alkyl" group is a branched or unbranched saturated hydrocarbon having 1 to 10 carbon atoms; the term "alkenyl group" is defined as a hydrocarbon group of 2 h 24 carbon atoms and the structural formula containing at least one carbon-carbon double bond; the term "alkynyl group" is defined as a hydrocarbon group of 2 to 24 carbon atoms and a structural formula containing at least one triple carbon30 carbon bond; the term "halogenated alkyl group" is defined as an alkyl group as defined above with one or more hydrogen atoms present in these groups substituted with a halogen (F, Cl, Br, I); The term "cycloalkyl group" is defined as an aromatic carbon base ring formed by at least three carbon atoms. Some examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term "heterocycloalkyl group" refers to a cycloalkyl group as defined above in which at least one of the ring carbon atoms is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus; the term "aliphatic group" is defined as groups that include alkyl, alkenyl, alkynyl, halogenated alkyl and cycloalkyl as defined above. A "lower aliphatic group" is an aliphatic group containing 1 to 10 carbon atoms; the term "aryl group" is defined as any aromatic carbon-based group that includes, but is not limited to, benzene, naphthalene, etc. The term "aromatic" also includes "heteroaryl group", which is defined as an aromatic group having at least one heteroatom incorporated within the ring of the aromatic group. Some examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus. The aryl group may be substituted with one or more groups that include, but are not limited to, alkyl, alkynyl, alkenyl, aryl, halide, nitro, amino, ester, ketone, aldehyde, hydroxy, carboxylic acid, or alkoxy, or the aryl group may be unsubstituted; the term "aralkyl" is defined
45 as an aryl group having an alkyl group, as defined above, attached to the aryl group. An example of an aralkyl group is a benzyl group; "esterification" refers to the reaction of an alcohol with a carboxylic acid or a carboxylic acid derivative to give an ester; "transesterification" refers to the reaction of an ester with an alcohol to form a new ester compound. The expression "3-hydroxybutyrate" is used interchangeably with the expression "3-hydroxybutyric acid".
A compound capable of raising ketone body concentrations includes compounds according to the formula:
image12
in which R is a polyhydric alcohol moiety; n, m and x represent whole numbers; and m is less than or equal to x.
5 Some physiologically compatible alcohols suitable for forming esters with (R) -3-hydroxybutyrate and derivatives thereof include monohydric and polyhydric alcohols. Some esters of polyhydric alcohols administer a higher density of equivalents of (R) -3-hydroxybutyrate per equivalent of derivative of (R) -3-hydroxybutyrate using shorter (R) -3-hydroxybutyrate oligomers. Some shorter oligomers usually hydrolyze more rapidly to give high concentrations of (R) -3-hydroxybutyrate in blood. Some examples of
Suitable polyhydric alcohols for preparing such esters include carbohydrates and carbohydrate derivatives, such as carbohydrate alcohols, some examples of carbohydrates include, without limitation, altrose, arabinose, dextrose, erythrose, fructose, galactose, glucose, gulose, idosa, lactose, lyxose, mannose, ribose, sucrose, talose, treosa, xylose and the like. Some additional examples of carbohydrates useful for preparing (R) -3-hydroxybutyrate derivatives include amino derivatives, such as galactosamine, glucosamine and mannosamine, including
N-acetyl derivatives, such as N-acetylglucosamine and the like. Some examples of carbohydrates also include carbohydrate derivatives, such as alkyl glycosides. Some examples of carbohydrate alcohols include, without limitation, glycerol, mannitol, ribitol, sorbitol, treitol, xylitol and the like. The enantiomers of the carbohydrates and carbohydrate alcohols listed above can also be used to prepare (R) -3-hydroxybutyrate derivatives according to the formula mentioned above.
Some embodiments include compounds in which n is from 1 to about 100; in which x is 1 to about 20; wherein m is 1 to about 20. One embodiment includes a compound in which R is (R) -1,3-butanediol.
Another compound capable of raising ketone body concentrations includes compounds of formula
image13
and also
image14
in which n and m independently are integers from 1 to about 100. In some embodiments, n and m are the same; n and m are different; and in others n and m are 3.
In addition, some compounds capable of raising ketone body concentrations include R-3-hydroxybutyrate ester compounds according to the formula
image15
wherein n is an integer from 1 to about 100. In one embodiment, n is 3. Other compounds capable of raising ketone body levels include 3-hydroxy acids. The compositions
image16
they include 3-hydroxy acids, linear or cyclic oligomers thereof, esters of the 3-hydroxy acids or oligomers, derivatives of 3-hydroxy acids, and combinations thereof. In one embodiment, the compositions include the cyclic macrolide of R-3-hydroxy acids containing 3, 4, or 5 monomeric subunits. Some 3-hydroxy acids include 3-hydroxybutyric acid, 3-hydroxyvaleric acid, 3-hydroxyhexanoic acid and 3-hydroxyheptanoic acid. In
In some embodiments, the length of the oligomer must be such that the derivative has an adequate digestion rate for sustained release of the monomer. In another embodiment, the cyclic trimer (triólido) is used in a combination with other cyclic oligolides or linear esters and / or mixtures of both.
The general formula for 3-hydroxy acids is: 10
image17
wherein R1 is selected from hydrogen, methyl, alkyl, alkenyl, aryl, arylalkyl, heteroalkyl, heteroaryl, thiol, disulfide, ether, thiol ether, amine, amide, halogen. R2 and R3 are independently selected from hydrogen, methyl,
Alkyl, alkenyl, aryl, arylalkyl, heteroalkyl, heteroaryl, thiol, disulfide, ether, thiol ether, amine, amide, halogen, hydroxy, ester, nitrogen substituted radicals, and / or oxygen substituted radicals. R4 is selected from hydrogen, alkyl, alkenyl, aryl, arylalkyl, heteroalkyl, heteroaryl, thiol, disulfide, ether, thiol ether, amine, amide, halogen, hydroxy, ester, nitrogen substituted radicals, and / or oxygen substituted radicals. In addition, when R4 is not hydrogen or a halogen, R3 can be a direct bond to R4 and R4 can be methyl.
Other compounds capable of increasing ketone body levels include glycerol esters, in particular, glycerides not immediately soluble in water of at least one keto or hydroxy acid, which has the formula
image7
25 in which two or three of the groups R1, R2 and R3 independently of each other, are one or more of the groups acetoacetate, alpha-ketopropionate, beta-hydroxybutyrate and alpha-hydroxypropionate, and when only two of the groups R1, R2 and R3 are any of said groups, the third of which is a hydroxy group or a residue of a saturated fatty acid containing from 2 to 24 carbon atoms. Other glycerol esters are envisaged, in particular
30 glycerides not immediately soluble in water of at least one keto or hydroxy acid, having the formula
image7
in which a group R is hydrogen, and the groups R are (--COCH2, COCH3). In addition, in which each R is the same or
35 is different and is hydrogen, or (--COCH2, COCH3), with the proviso that at least one R is not hydrogen and in which R 'is a linear acid ester of an even number of carbons of 2 to 20 carbons .
Compositions in administratively convenient formulations that include dosage units incorporated in various packages are also disclosed. Some dosages of the compositions of the invention, such
40, such as those comprising MCT, can be administered in an amount effective to increase the cognitive capacity of patients affected with diseases of neuronal metabolism reduction, such as in patients with any cognitive decline associated with disease or with age , such as, AD, AAMI, and the like.
In one embodiment, the compounds of the invention result in increased ketone concentrations in the body, and in this embodiment, the compositions are administered in an amount that is effective in inducing hypercetonemia. In one embodiment, hypercetonemia results in ketone bodies that are used to energize the brain.
image18
In one embodiment, the composition increases the concentration in circulation of at least one type of ketone bodies in the mammal or patient. In one embodiment, the circulating ketone body is D-beta-hydroxybutyrate. The amount of ketone bodies in circulation can be measured a number of times after administration, and in one embodiment, it is measured at the time when it is predicted to be close to the maximum concentration in 5 blood, but it can also be measured. before or after the predicted level of maximum blood concentration. The measured quantities of these moments outside the peak hours are then adjusted optionally to reflect the predicted level in the predicted maximum time. In one embodiment, the maximum predicted time occurs in approximately two hours. The maximum level of blood in circulation and the timing may vary depending on factors known to those skilled in the art, including individual digestive rates, co-ingestion or prior or subsequent ingestion of food, beverages, etc., as one skilled in the art knows. matter. In one embodiment, the maximum blood level reached from D-beta-hydroxybutyrate is between about 0.05 millimolar (mM) and about 50 mM. Another way to determine if blood D-beta-hydroxybutyrate levels rise from about 0.05 mM to about 50 mM is by measuring the urine exception of D-betahydroxybutyrate at a rate in the range of about 5 mg / dl approximately 160 mg / dl. In another 15 embodiments, at maximum blood level it rises from about 0.1 mM to about 50 mM, from about 0.1 mM to about 20 mM, from about 0.1 mM to about 10 mM, from about 0.1 mM to about 5 mM, more preferably it rises from about 0.15 mM to about 2 mM, from about 0.15 mM to about 0.3 mM, and from about 0.2 mM to about 5 mM, although variations will necessarily occur depending on of the formulation and the host, for example, as discussed above. In other embodiments, the maximum level of blood D-beta-hydroxybutyrate reached will be at least about 0.05 mM, at least about 0.1 mM, at least about 0.15 mM, at least about 0.2 mM, at at least about 0.5 mM, at least about 1 mM, at least about 1.5 mM, at least about 2 mM, at least about 2.5 mM, at least about 3 mM, at least
About 4 mM, at least about 5 mM, at least about 10 mM, at least about 15 mM, at least about 20 mM, at least about 30 mM, at least about 40 mM, and at least about 50 mM.
Some effective amounts of compound dosages for the compositions of the invention, ie compounds capable of raising ketone body concentrations in an amount effective for treatment.
or the prevention of loss of cognitive function caused by reduction of neuronal metabolism will be apparent to those skilled in the art. As discussed hereinbefore, such effective amounts can be determined in view of the levels of blood ketone disclosed. When the compound capable of elevating temptations of ketone bodies is MCT, the dose of MCT, in one embodiment, is in the range of about 0.05 g / kg / day to about 10 g / kg / day of MCT. In other embodiments, the dose will be in the range of about 0.25 g / kg / day to about 5 g / kg / day of MCT. In other embodiments, the dose will be in the range of about 0.5 g / kg / day to about 2 g / kg / day of MCT. In other embodiments, the dose will be in the range of about 0.1 g / kg / day to about 2 g / kg / day. In other embodiments, the dose of MCT is at least about 0.05 g / kg / day, at least about 0.1 g / kg / day, at least about 0.15 g / kg / day, at least about 0 , 2 g / kg / day, at least about 0.5 g / kg / day, at least about 1 g / kg / day, at least about 1.5 g / kg / day, at least about 2 g / kg / day, at least about 2.5 g / kg / day, at least about 3 g / kg / day, at least about 4 g / kg / day, at least about 5 g / kg / day, at least about 10 g / kg / day, at least about 15 g / kg / day, at least about 20
45 g / kg / day, at least about 30 g / kg / day, at least about 40 g / kg / day, and at least about 50 g / kg / day.
Some convenient unit dosage and / or dosage formulations include tablets, capsules, lozenges, troches, hard candies, nutritional bars, nutritional drinks, metered dose sprays, creams and suppositories, among others. The compositions may be combined with a pharmaceutically acceptable excipient such as gelatin, oil (s), and / or other pharmaceutically active agent (s). For example, the compositions may be combined and / or advantageously used in combination with other therapeutic agents.
or prophylactic, different from the subject compounds. In many cases, administration in conjunction with the subject compositions increases the effectiveness of such agents. For example, the compounds can be used in a manner
Advantageous in conjunction with antioxidants, compounds that increase the efficiency of glucose utilization, and mixtures thereof.
A subject can be infused intravenously with ketogenic compounds such as MCT, MCFA, directly, to a level necessary to treat and prevent the onset of neuronal metabolic reduction diseases. Those skilled in the art are well aware of the preparation of intravenous solutions of lipids and ketone bodies.
Also disclosed herein is a formulation comprising a mixture of MCT and carnitine to provide elevated blood ketone levels. The nature of such formulations will depend on the duration and route of administration. Such formulations may be in the range of 0.05 g / kg / day to 10 g / kg / day of MCT and 65 from 0.05 mg / kg / day to 10 mg / kg / day of carnitine or its derivatives. In one embodiment, a dose of MCT may be in the range of 0.05 g / kg / day to 10 g / kg / day of MCT. The dose may be in the range of 0.25 g / kg / day to 5
image19
g / kg / day of MCT. The dose may also be in the range of 0.5 g / kg / day to 2 g / kg / day of MCT. In some embodiments, a dose of carnitine or carnitine derivative may be in the range of 0.05 mg / kg / day to 10 mg / kg / day. The dose of carnitine or carnitine derivative may be in the range of 0.1 mg / kg / day to 5 mg / kg / day. The dose of carnitine or carnitine derivative may also be in the range of 0.5 mg / kg / day to 1 mg / kg / day. By
For example, variations will necessarily occur depending on the formulation and / or the host.
In one embodiment, a formulation comprises a range of about 1 to about 500 g of emulsified MCT combined with about 1 to about 2000 mg of carnitine. Some amounts of MCT may be at least about 1 g, at least about 10 g, at least
10 about 50 g, at least about 100 g, at least about 150 g, at least about 200 g, at least about 250 g, at least about 300 g, at least about 400 g. Some amounts of carnitine may be at least about 1 g, at least about 50 g, at least about 100 g, at least about 250 g, at least about 500 g, at least about 1000 g, at least about 1250 g, at least
15 approximately 1500 g. Another formulation comprises 50 g of MCT (95% triC8: 0) emulsified with 50 g of mono and diglycerides combined with 500 mg of L-carnitine. Such a formulation is well tolerated and generally induces hypercetonemia for 3-4 hours in human subjects.
The daily dose of MCT can also be measured in terms of grams of MCT per kg of body weight (BW) of the
20 mammal The daily dose of MCT can vary from about 0.01 g / kg to about 10.0 g / kg of mammalian BW. Preferably, the daily dose of MCT is from about 0.1 g / kg to about 5 g / kg of mammalian BW. More preferably, the daily dose of MCT is about 0.2 g / kg to about 3 g / kg of the mammal. Even more preferably, the daily dose of MCT is from about 0.5 g / kg to about 2 g / kg of the mammal.
In some embodiments, the compounds of the invention can be co-administered with carbohydrate, or they can be co-formulated with carbohydrate. Some carbohydrates may include more than one type of carbohydrate. Some suitable carbohydrates are known in the art, and include simple sugars, such as glucose, fructose, sucrose, and the like, from conventional sources such as corn syrup, sugar beet, and the like. Whether
30 coformulan, the amount of carbohydrate to be used may include at least about 0.1 g, at least about 1 g, at least about 10 g, at least about 50 g, at least about 100 g, at least about 150 g, at least about 200 g, at least about 250 g, at least about 300 g, at least about 400 g. The amounts of carnitine can be at least about 1 g, at least about 50 g, at least about
35 100 g The compositions may comprise from about 15% to about 40% carbohydrates, on a dry weight basis. Some sources of such carbohydrates include grains or cereals such as rice, corn, sorghum, alfalfa, barley, soy beans, rape, oats, wheat, or mixtures thereof. The compositions also optionally comprise other components comprising carbohydrates such as whey powder and other dairy products or by-products.
In another embodiment, the methods of the present invention further comprise genotype determination.
or alleles in particular of the patients. In one embodiment, the alleles of the patient's apolipoprotein E gene are determined. Some non-E4 vehicles were found to obtain better results than those with the E4 allele when high levels of ketone bodies were induced with MCT. In addition, individuals with the E4 allele
45 had higher levels of fasting ketone bodies and the levels continued to increase over the two hour time interval. Therefore, E4 vehicles may require higher levels of ketone or agents that increase the ability to use the ketone bodies that are present.
In another embodiment, the compositions comprising compounds capable of increasing the concentrations of
50 ketone bodies are food products formulated specifically for human consumption. These will include foods and nutrients intended to provide the necessary dietary requirements for a human being, as well as other human dietary supplements. In one embodiment, food products formulated for human consumption are complete and nutritionally balanced while in others they are provided as nutritional supplements for use in connection with a well-balanced or formulated diet.
In another embodiment, the composition is a food supplement, such as drinking water, beverage, liquid concentrate, gel, yogurt, powder, granules, pasta, suspension, chewing gum, piece, candy, snack, granule, pill, capsule, tablet, or any other form of administration. Nutritional supplements can be specially formulated for consumption by a particular species or even a mammalian individual, such as mammalian
60 company, or a human being. In one embodiment, the nutritional supplement may comprise a relatively concentrated dose of MCT in such a way that the supplement can be administered to the mammal in small amounts, or it can be diluted before administration to a mammal. In some embodiments, the nutritional supplement or other composition containing MCT may need to be mixed with water or the like before administration to the mammal, for example to adjust the dose, to make it more palatable, or
65 to allow more frequent administration in smaller doses.
image20
Some sources of the MCT include any suitable, semi-synthetic, synthetic or natural source. Some examples of natural MCT sources include vegetable sources such as coconuts and coconut oil, palm seeds and palm kernel oils, and animal sources such as milk of any of various species, for example, goats. 5 Examples
The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention. EXAMPLE 1 PHARMACOGENOMICS IN A TREATMENT OF ALZHEIMER'S DISEASE BASED ON KETONIC BODIES
A promising treatment for Alzheimer's disease is the induction of ketosis. The study of KET-04-001 examined the pharmacogenomic effects of several genetic markers in a group of patients with AD from mild to
Moderately treated with a ketogenic agent. The test compound was AC-1202. AC-1202 is a medium-chain triglyceride (MCT) formulation designed to safely increase serum ketone bodies even in the presence of dietary carbohydrates. MCTs were chosen for this study due to their excellent safety profile and long historical use in lipid malabsorption disorders and ketogenic diets. Due to the unique physical properties of AC-1202, it is metabolized differently than the most common long chain triglycerides (LCT). If sufficiently high amounts of AC-1202 are consumed, a mild ketosis state can be induced. Subjects
25 Two hundred fifty-three participants were systematically identified with a probable diagnosis of AD. The study recruited outpatients with a probable diagnosis of AD of mild to moderate severity according to the NINCDS-ADRDA and DSM IV criteria, with an MMSE score between 14 and 24 (inclusive) in the Systematic Identification. A CT or MRI within 24 months before the Systematic Identification did not have to show any sign of tumor, structural abnormality, or degenerative disease. Subjects were required to submit a score ≤ 4 on the Hachinski Modified Ischemia Scale. The subjects and their caregivers provided informed consent, which included an optional provision of type training. At their discretion, some participants were able to provide consent to be tested for APOE, and / or additional DNA markers. Genetic information was not shared with facility staff
or participants in the study.
35 The fundamental exclusion criteria in systematic identification included: major depression as determined with a Cornell Scale for Depression in Dementia score ≥ 13, clinically significant hypothyroidism as determined by the evaluation of thyroid function, B12 deficiency clinically significant within 12 months before the initial Measure, clinically significant kidney disease or insufficiency, clinically significant liver disease, and any type of diabetes.
Subjects currently receiving approved AD medications were eligible for enrollment in the study on the condition that they had been maintained at a stable dosage for at least 3 months before the systematic Identification and were asked to remain stable at the dosage. during all the
45 study period. Study design
The subjects were randomized in a ratio of 1: 1 to receive either AC-1202 or Placebo pairing for 90 days. A permuted block random classification code with a block size of 4 was used. Subjects were provided with study kits marked with a unique site and subject number. Participants, those who administer the interventions, and those who evaluate the results were concealed group assignments. The subjects who left the study prematurely were substituted and assigned to the product under investigation with a medical monitor without independent concealment in a way to achieve
55 approximately 50 subjects within each treatment group.
The product under investigation was formulated as an emulsified spray-dried powder consisting of 33% AC-1202 (Neobee 895, Stepan Chemical Company), 64% Arabic gum (Instagum, CNI) and 2.6% of siloid (244FP, Grace Davison). The placebo was isocaloric to the active formulation and consisted of a mixture of 51% gum arabic, 37% dextrose, 10% safflower oil and 2% siloid (prepared by the Chemins Company). The product under investigation is provided as a powder packaged in 30 g sachets containing active compound (equivalent to 10 grams of AC-1202) or Placebo pairing.
The contents of the sachets had to be mixed in an 8 oz glass. of a liquid such as water, milk or
65 juice before consumption. These instructions were subsequently modified to recommend reconstitution with a meal replacement drink, Ensure ™ (Abbott Laboratories), to improve product tolerance.
image21
During the first seven days of the study, the subjects received an envelope of 30 g per day. On Day 8, each subject was asked to increase the dose to two sachets of 30 g per day, and continue with that dose until Day 90. Daily doses were administered during breakfast, except for the days of visiting the hospital. clinic when participants were asked to have breakfast before their scheduled visit.
5 Safety assessments included physical exams, vital signs measurements, routine serum chemistry and hematology tests, and electrocardiograms were performed with Systematic Identification on Day 104. Emerging adverse events from treatment and any changes in simultaneous administration of medication were recorded in all clinic visits. Tests of concentration levels of β-hydroxybutyrate
Serum samples were collected before and after dosing and analyzed at Allied Research International (formerly SFBC) of Miami, FL using the Liquicolor® diagnostic type for BHB provided by
15 Stanbio Laboratories (Boenre, TX). The normal range (12-hour fasting period) is 0.02 mM to 0.27 mM. Statistic analysis
A treatment intervention analysis (ITT) was used as the primary efficacy analysis, which included all subjects who were randomized, received study medication, and those who completed at least one follow-up visit. All missing efficacy data were attributed using the last observation imputation method (LOCF). The primary endpoints established a priori were the change from the initial ADAS-Cog measure and the overall ADCS-CGIC scores on Day 90. The secondary outcome measures included the MMSE, and the interactions associated with the APOE genotype. and concentration levels of
25 BHB.
A general two-way ANCOVA was used to assess the effect of treatment, along with the effects of genotype and treatment with genotype interactions for Cmax of serum BHB levels on Day 90. The ANCOVA model included independent factors for treatment, genotype and treatment with genotype interactions. A variable for serum BHB level in the initial measure was included as a covariate. The correlations between Cmax of serum BHB level on Day 90 and the change in the total score from the initial measurement were determined with Pearson's correlation statistics.
Genotyping
35 Several genetic markers were chosen for their ability to influence the efficacy of a ketone body therapy in Alzheimer's disease in the Study of KET-04-001. Genetics were formed with the participants in the Study of KET-04-001 who consented to an additional genetic analysis by polymerase chain reaction sequencing for 15 single nucleotide polymorphisms (SNPs) in the genes of IDE, LDLR, APOE, PON1 , IGFR1 and IL1B (described in more detail below). Genotyping was achieved as follows: Genomic DNA was extracted from EDTA anticoagulated venous blood with the use of a QIA-amp mini-reagent set for Blood-DNA (Qiagen) according to the manufacturer's instructions. The DNA was eluted in 200 µl of water in the final stage and stored at -20 ° C until needed. Individual primer sets as described anywhere in this document were used to amplify regions.
45 that contained the polymorphism of interest. The DNA was amplified in 5X buffer [300 mM Tris-HCl, pH 9.0, 62.5 mM (NH4) 2SO4], 2 mM MgCl2, four dNTP (dATP, dCTP, dGTP, and dTTP; 250 uM each) , 1U of AmpliTaq DNA polymerase, and 8 pmol of each of the primers in a final volume of 20 ul. The samples were denatured at 95 ° C for 3 min, hybridized at 47 ° C for 60 s, and elongated at 72 ° C for 60 s. This was followed by 35 cycles of denaturation (15 s at 95 ° C), hybridization (30 s at 47 ° C), and extension (20 s at 72 ° C). The final cycle was followed for 10 min at 72 ° C and 1 min at 25 ° C. Genotyping was determined through direct sequencing of PCR products using the ABI PRISM BigDye Termination Cycle Ready Sequencing Kit and analyzed in an ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA, USA).
The presence of IDE_7 or rs2251101 of IDE was determined by PCR amplification and sequencing of a
55 region of genomic DNA isolated from each patient (a relevant portion of this gene is shown in SEQ ID NO: 3). The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 1 (CAGCACTTTAGGAGGCCAAG) and SEQ ID NO: 2 (CTGCCCTTACAGGGATGAAA) were used to generate a 682 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
The presence of homozygosis for A for rs2229765 in an insulin-like growth factor 1 receptor precursor (IGFR-1) (a relevant portion of this gene is shown in SEQ ID NO: 6) was determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient. The region
65 amplified contained polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 4 (GGCTTAGAGTTCCCCCAAAG) and SEQ ID NO: 5 (CTTGCTGATGCCTGTGTTGT) were used to generate a 529 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
image22
The presence of homozygosis for T in rs1143627 of IL1B (a relevant portion of this gene is shown in the SEC
5 ID NO: 9) as well as the presence of homozygosis for C in rs16944 of IL1B (a relevant portion of this gene is shown in SEQ ID NO: 10) was detected by PCR amplification and sequencing of an isolated genomic DNA region of each patient. The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 7 (CACAAAGAGGCAGAGAGACAGA) and SEQ ID NO: 8 (GTCTTGCAGGGTTGTGTGAG) were used to generate a
10 fragment of 799 bp. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
The LDLR rs2738447 genotype was determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient. The amplified region contained the polymorphism. PCR was performed using
15 conventional molecular biology techniques. The primers of SEQ ID NO: 13 and SEQ ID NO: 14 were used to generate a 590 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
The rs7259278 genotype of LDLR was determined by PCR amplification and sequencing of a region of
20 genomic DNA isolated from each patient. The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 13 and SEQ ID NO: 14 were used to generate a 590 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
The genotype of rs11669576 of LDLR was determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient. The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 11 (CACCTGGCTGTTTCCTTGAT) and SEQ ID NO: 12 (TTCCTGTTCCAC-CAGTAGGG) were used to generate a 530 bp fragment. This fragment was purified and then sequenced using sequencing techniques.
30 with fluorescence to determine the genotype of each patient.
The genotype for rs1799898 of LDLR was determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient (a relevant portion of this gene is shown in SEQ ID NO: 15). The amplified region contained the polymorphism. PCR was performed using conventional biology techniques.
35 molecular. The primers of SEQ ID NO: 13 (GTCACAG-GGGAGGGGTTC) and SEQ ID NO: 14 (CTACTGGGGAGCCTGAGACA) were used to generate a 590 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
40 The heterozygous genotype for the rs1803274 K variant of Butyrylcholine esterase (BCHE) (a relevant portion of this gene is shown in SEQ ID NO: 18) was determined by PCR amplification and sequencing of an isolated genomic DNA region of each patient The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The direct primer had SEQ ID NO: 16 (CAGTTAATGAAACAGATAAAAATTTT) and the reverse primer had SEQ ID NO: 17
45 (CAATATTATCCTTCTGGATT).
The genotype of the rs405509 variant of the Apolipoprotein E promoter (APOE) is determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient (a relevant portion of this gene is shown in SEQ ID NO: 21) . The amplified region contained the polymorphism. PCR is
50 performed using conventional molecular biology techniques. The primers of SEQ ID NO: 19 (GCCTAGCCCCACTTTCTTTT) and SEQ ID NO: 20 (AGGTGGGGCATAGAGGTCTT) were used to generate a 587 bp fragment. This fragment was purified and then sequenced using fluorescence sequencing techniques to determine the genotype of each patient.
55 Genotype detection for rs662 paraoxonasa / arilesterase 1 (PON1) in serum: it is determined by PCR amplification and sequencing of a region of genomic DNA isolated from each patient. The amplified region contained the polymorphism. PCR was performed using conventional molecular biology techniques. The primers of SEQ ID NO: 22 (AAGGCTCCATCCCACATCTT) and SEQ ID NO: 23 (TCATCACAGTTCCCCCTCTT) were used to generate a 574 bp fragment. This fragment was purified and then sequenced using
60 fluorescence sequencing techniques to determine the genotype of each patient.
The IUPAC-IUB / GCG Ambiguity Codes were used for snps. The table below provides: 1. The ambiguity codes used in the DNA sequences 2. which of the four bases (A, C, T, G) is represented by codes 3. the complement of the ambiguity code
65
image23
IUPAC-IUB / GCG code MeaningComplement
TOTO T
CC G
GG C
YOU TTO
M A or CK
R A or GY
W A or T W
S C or G S
Y C or TR
K G or TM
V A or C or GB
H A or C or TD
D A or G or TH
B C or G or TV
X / N G or A or T or CX
. neither G or A nor T or C . Genotype frequency
The frequency and number of each genotype is shown in Table 1. Note that, c refers to an individual who is a homozygous for c / c, het refers to a heterozygous for that SNP. Note that in some cases a genotype could not be assigned without ambiguity and these are represented with a ’ ’ Symbol.
Table 1 Frequency and genotype counts Gen SNP Genotype Count Frequency
IL1B rs1143627 C 15 0.11719 Het 53 0.41406 T 60 0.46875


image24
image25 Genotype Frequency
5 The frequency of each polymorphism was examined with respect to data published in the w HapMap project (www.hap-map.org). In some cases, HapMap data was not available and other databases were used, such as the DECODE database. The HapMap database is based on a relatively small sampling of humans from different geographic locations around the world. There are four main groups of people. The first group are the individuals of the Yoruba people of the peninsula of
10 Ibadan in Nigeria (called YRI). The second group is from the CEPH project in Utah, exclusively Americans of European descent (called CEU). The third group is made up of individuals from the Chinese population of Han from Beijing (called CHB). The fourth group consists of unrelated individuals of Japanese descent from the Tokyo area (called JPT).
15 In most cases, the frequencies found in the study of KET-04-001 were in accordance with the published frequencies of an American population of European descent from Utah. In the study of KET-04-001, 94.5% of the subjects were also indicated as Caucasian / white, 4.8% Hispanic and 0.7% black.
20 In some cases, the frequencies differed. For example, the frequency of the C / C genotype of rs2251101 of IDE was quite low in the HapMap database (0.0314) and considerably higher in the study of KET-01-004 (0.117). The highest frequency of the c / c genotype in the study of KET-04-001 is probably because the Accera study uses a population of AD. The C / C genotype has been identified in some studies as a risk factor for AD.
25 In addition, some ApoE promoter polymorphisms differ slightly in the population of KET-04-001 compared to European random sampling. This is also consistent with the well-known association of ApoE and AD. Study population
30 In this study, one hundred fifty-two subjects were randomly classified. 140 subjects completed at least one follow-up visit after the initial Measurement, these subjects comprise the ITT population used for efficacy analysis. The treatment groups were well balanced for initial measurement characteristics. One hundred thirty-five subjects (n = 75 BC; n = 60 PL) agreed to perform genotyping for the APOE site.
35 Ketosis
image26
BHB levels were determined with Systematic identification (previous dose), Initial measurement, Day 45, Day 90 (before and after the dose) and Day 104 (previous dose). The levels after the dose were measured two hours after the administration of the product under investigation. BHB levels of systematic identification
5 were within normal ranges and did not differ between treatment groups (AC 0.11 ± 0.08 mM; PL 0.12 ± 0.11 mM, p = 0.590). Two hours after the dose, AC-1202 induced a significant increase in serum BHB levels on visiting days for Initial Measurement, Day 45 and Day 90. In the Initial Measurement, subjects received ½ dose of AC-1202 and The mean serum BHB increased from 0.07 mM to 0.14 mM, which was significantly different from the Placebo group (p <0.0001). The highest levels of BHB were obtained with the full dose. The mean values of BHB after the 2-hour dose in the AC-1202 group were 0.36 mM on Day 45 and 0.39 mM on Day 90, both significantly different from the Placebo group (p <0, 0001). The levels of BHB were not different between the groups with AC-1202 and Placebo in any previous dose sampling or after the time necessary for the body to eliminate all the drug administered for 14 days. 15 ADAS-Cog
When ADAS-Cog scores were evaluated on Day 45 in the ITT population with LOCF, there was a significant effect of treatment with AC-1202 on the change from the initial Measurement on ADAS-Cog scores. Subjects treated with AC-1202 showed an average change from the initial Measure of 0.177 points (the negative score represents an increase with respect to the Initial Measure), while those treated with Placebo presented an average change of 1.73 points (p = 0.024). On Day 90, the AC-1202 led to an average change of -0.31 points from the initial Measurement in ADAS-Cog, while the Placebo group presented an average change of 1.23 points (p = 0.077) . On Day 104, after the time necessary for the body to eliminate all the drug administered for two weeks, there was no difference in the ITT population
25 between treatment groups (p = 0.405). Effects of Genotype in ADAS-Cog
The genetic influence of treatment with ketone bodies was examined for a series of genetic markers in correlation with the change on Day 90 from the Initial Measurement in ADAS-Cog. Analysis of ADAS-Cog scores revealed that the transport status of several of the markers tested demonstrated an increase in the efficacy of treatment with AC-1202 (see Table 2).
rs2551101 of IDE. Subjects who were heterozygous at the rs2551101 site demonstrated an increase of 4.06
35 points in the ADAS-Cog score when compared to placebo (p = 0.0068). Subjects who were not homozygous for the C allele demonstrated an increase of 2.74 points in ADAS-Cog when compared to placebo (p = 0.0059).
rs1143627 of IL1B. Subjects who were homozygous for the T allele demonstrated a 3.5 point increase in ADAS-Cog when compared to placebo (p = 0.0145).
rs16944 of IL1B. Subjects who were homozygous for the C allele demonstrated a 3.5-point increase in ADAS-Cog when compared to placebo (p = 0.0145).
45 rs229765 of IGF1R. Subjects who were homozygous for the A allele demonstrated an increase of 7.3 points in ADAS-Cog when compared to placebo (p = 0.0072).
rs28401726 of IGF1R. No significant effects were observed with this allele.
rs662 of PON1. No significant effects were observed with this allele.
rs7259278 of LDLR. Subjects who were homozygous for the G allele demonstrated an increase of 2.56 points in ADAS-Cog when compared to placebo (p = 0.0236).
55 LDLR rs2738447. Subjects who were homozygous for the C allele demonstrated an increase of 3.51 points in ADAS-Cog when compared to placebo (p = 0.037).
rs1799898 of LDLR. Subjects who were homozygous for the C allele demonstrated an increase of 2.44 points in ADAS-Cog when compared to placebo (p = 0.045).
rs11669576 of LDLR. No significant effects were observed with this allele.
rs1803274 from BUCHE. Subjects who were heterozygous at the rs1803274 site demonstrated an increase of 4.29 points in the ADAS-Cog score when compared to placebo (p = 0.0133).
65 APOE rs448647. No significant effects were observed with this allele.
image27
APOE rs405509. Subjects who were heterozygous at the rs405509 site demonstrated an increase of 3.68 points in the ADAS-Cog score when compared to placebo (p = 0.0085).
APOE rs769446. No significant effects were observed with this allele.
Table 2 Treatment by Genotype
Change in ADAS-Cog from the Initial Measure on Day 90
Treatment Genotype * with 2-way Anova
Snp GenotypeN for AC-1202N for PlaceboP-value
APOE rs449647 to39380.147
Het 17eleven0.14
t 330.4
APOE rs405509 geleven70.48
Het 26270.0085
t 2. 3180.629
APOE rs769446 Het560.405
t 55460.0951
BUCHE rs1803274 to2Na
g 40390.541
Het 25fifteen0.0133
IDE rs2251101 C970.079
Het 22250.0068
t 36240.266
rs2229765 from IGF1R TO5130.00719
G 27180.156
het 3. 4250.826
rs28401726 of IGF1R C52480.0578
het 1450.901
G 2Na
rs16944 of IL1B C29270.0145
het 28170.845
T 690.479
rs1143627 of IL1B C690.479
Treatment Genotype * with 2-way Anova
Snp GenotypeN for AC-1202N for PlaceboP value
het 28170.845
T 29270.0145
rs11669576 of LDLR8 G59510.025
het 850.458
rs688 of LDLR13 C24220.987
het 33twenty0.061
T 7130.061
rs2738447 of LDLR13 TO13eleven0.77
C 18twenty-one0.037
het 32220.176
rs7259278 of LDLR13 G44440.0236
het 1780.403
T 220.974
rs1799898 of LDLR 13 C40350.045
het 18fifteen0.126
T oneone0.819
rs662 of PON1 TO28260.12
G 670.239
het 322. 30.73
IDE rs2251101 DC970.079
other 58490.0059
AI program source: phg Tab 3
image28 ADCS-CGIC and MMSE
When AC-1202 and Placebo are compared in the ITT population using LOCF, AC-1202 did not lead to a significant difference in the distribution of ADCS-CGIC scores in any study.
Table 2 Treatment by Genotype: ADCS-CGIC Score on Day 90
P value of the Treatment Genotype * with 2-way Anova
Snp genotip oN for KetasynN for Placebo
Apoe4 0 129 3926 310.218 0.769
APOE rs449647 to het t39 17 338 11 330.201 0.604 0.796
APOE rs405509 g het t11 26 237 27 180.6868 0.5660 0.7090
APOE rs769446 het t5 556 460.441 0.274
BUCHE rs1803274 to g het2 40 2539 15Na 0.356 0.574
IDE rs2251101 c het t9 22 367 25 240.789 0.569 0.259
rs2229765 from IGF1R to g het5 27 3413 18 250.350 0.871 0.585
rs28401726 of IGF1R c het g52 1448 5 20.299 0.292 Na
rs16944 of IL1B c het t29 28 627 17 90.839 0.492 0.437
rs1143627 of IL1B c het t6 28 299 17 270.437 0.492 0.839
rs11669576 of LDLR8 g het59 851 50.538 0.935
rs688 of LDLR13 c het t24 33 722 20 130.436 0.662 0.295
rs2738447 of LDLR13 to c het13 18 3211 21 220.635 0.993 0.147
rs7259278 of LDLR13 g het t44 17 244 8 20.288 0.552 1
rs1799898 of LDLR 13 c het t40 18 135 15 10.175 0.986 0.321
rs662 of PON1 to g het28 6 3226 7 230.408 0.975 0.722
IDE rs2251101 c / c other9 587 490.494 0.790
AI program source: phg Tab 5
Significant effects of the treatment on the change were found from the Initial Measure in MMSE in Vehicles of rs405509 of APOE and rs662 of PON1.
image29
Table 3 Treatment by Genotype: Change in MMSE from the Initial Measure on Day 90
P value of the Treatment Genotype * with 2-way Anova
Snp genotypeN for KetasynN for Placebo
Apoe4 0 129 3926 310.369 0.704
APOE rs449647 To het t39 17 338 11 330.595 0.424 0.277
APOE rs405509 G het T11 26 237 27 180.929 0.067 0.037
APOE rs769446 het T5 556 460.504 0.834
BUCHE rs1803274 To G het2 40 2539 15Na 0.892 0.413
IDE rs2251101 C het T9 22 367 25 240.908 0.206 0.111
rs2229765 from IGF1R To G het5 27 3413 18 250.125 0.929 0.844
rs28401726 of IGF1R C het G52 1448 5 20.392 0.254 Na
rs16944 of IL1B C het T29 28 627 17 90.846 0.943 0.879
rs1143627 of IL1B C het T6 28 299 17 270.879 0.943 0.846
rs11669576 of LDLR8 G het59 851 50.756 0.762
rs688 of LDLR13 C het T24 33 722 20 130.240 0.365 0.468
rs2738447 of LDLR13 A C het13 18 3211 21 220.709 0.265 0.513
rs7259278 of LDLR13 G het T44 17 244 8 21 0.903 0.859
rs1799898 of LDLR 13 C het T40 18 135 15 10.322 0.145 0.799
rs662 of PON1 To G het28 6 3226 7 230.085 0.031 0.287
IDE rs2251101 c / c other9 587 490.682 0.909
AI program source: phg Tab 4 Adverse Events that Occur Before and After a Change in Dosing Protocol
5 During the first several months of the study, it seemed that the study would withdraw a relatively large number of subjects due to gastrointestinal adverse events, in particular due to diarrhea and flatulence. After an evaluation of the reasons given for the discontinuation, it was recommended that the study medication or placebo should be mixed with a high protein drink (Ensure ™) to increase the tolerability of the product under investigation. This decision was reported to the clinical sites and subsequently provided with a
10 ample supply of Ensure for distribution to study subjects. Although no specific data were collected regarding which subjects adhered to the mixing instructions for the new medication, Accera had reason to believe that Ensure ™ became available to all subjects who were in the study at the time point or They signed up after the change.

权利要求:
Claims (8)
[1]
image 1
1. A method of selecting a patient for treatment of reduced cognitive function related to
disease caused by reduction of neuronal metabolism associated with Alzheimer's disease (AD), method 5 comprising:
to. select a patient who has reduced cognitive function related to the disease caused by reduction of neuronal metabolism associated with Alzheimer's disease (AD);
b. determine in the patient the presence of at least one of the specific genotypes selected from the group consisting of:
i. homozygosis for cytosine of rs2738447 of Low Density Lipoprotein Receptor (LDLR) in a relevant portion shown by SEQ ID NO: 24,
ii. homozygosis for guanine of LDLR rs7259278 in a relevant portion shown by SEQ ID NO: 25, and
15 iii. homozygosis for cytosine of rs1799898 of LDLR in a relevant portion shown by SEQ ID NO: 15; Y
C. selecting a patient who has at least one of the specific genotypes in (b) for treatment, wherein the treatment comprises the administration to the patient of at least one medium chain triglyceride (MCT) in an amount effective for the treatment or prevention of the reduction of cognitive function related to the disease by reduction of neuronal metabolism associated with Alzheimer's disease.
[2]
2. A medium chain triglyceride for use in a method of treatment or prevention of reduced cognitive function related to the disease caused by reduced neuronal metabolism associated with the disease of
Alzheimer's in a patient, wherein the method of treatment comprises selecting the patient according to the method of claim 1.
[3]
3. The method according to claim 1 or the MCT for use in a method for treating cognitive function related to the disease caused by reduction of the neuronal metabolism associated with Alzheimer's disease according to claim 2, further comprising the step of determine the absence of ApoE4 genotype.
[4]
Four. The method according to claim 1 or the MCT for use according to claim 2 wherein the
The method further comprises determining in the patient the presence of at least one genotype selected from the group consisting of:
i. heterozygous for C / T for rs2551101 of Insulin Degradant Enzyme (IDE) in a relevant portion shown by SEQ ID NO: 3,
ii. absence of homozygosis for C / C of rs2551101 of IDE in a relevant portion shown by SEQ ID NO: 3,
iii. heterozygous for A / C of rs405509 of Apolipoprotein E (ApoE) in a relevant portion shown by SEQ ID NO: 21,
iv. heterozygous for G / A of rs1803274 of Butyrylcholine esterase (BUCHE) in a relevant portion shown by SEQ ID NO: 18,
45 v. homozygosis for rs2229765 adenine of the Insulin-like Growth Factor Receptor Precursor in a relevant portion shown by SEQ ID NO: 6,
saw. homozygosis for thymine of rs1143627 of Interleukin-1 beta (IL1B) in a relevant portion shown by SEQ ID NO: 9, and
vii. homozygosis for cytosine of rs16944 of IL1B in a relevant portion shown by SEQ ID NO: 10.
[5]
5. The MCT for use according to claim 2, wherein the medium chain triglycerides (MCT) have the formula:
image2
wherein R1, R2 and R3 esterified to the main glycerol chain are each independently fatty acids having 5-12 carbon chains.
[6]
6. The MCT for use according to claim 2, wherein the composition is an oral composition further comprising glucose.
[7]
7. The MCT for use according to claim 2, wherein the MCT is administered in an amount effective to raise the level of D-beta-hydroxybutyrate in blood in the patient from about 0.1 mM to about 50 mM.
35
image3
The MCT for use according to claim 2, wherein the MCT is administered in an amount effective to raise the level of D-beta-hydroxybutyrate in blood in the patient from about 0.2 mM to about 5 mM .
[9]
9. The MCT for use according to claim 5 wherein the composition is administered in a dose of from about 0.05 g / kg / day to about 10 g / kg / day.
36

类似技术:

---

公开号 | 公开日 | 专利标题

---

ES2608286T3|2017-04-07|Use of genomic assays and ketogenic compounds for treatment of reduced cognitive function

---

US8748400B2|2014-06-10|Use of ketogenic compounds for treatment of age-associated memory impairment

---

AU2014259587B2|2017-07-13|Use of genomic testing and ketongenic compounds for treatment of reduced cognitive function

同族专利:

---

公开号 | 公开日

---

EP2650381B1|2016-09-21|

---

EP2650380B1|2015-09-16|

---

ES2556537T3|2016-01-18|

---

KR20100044871A|2010-04-30|

---

EP2650378B1|2015-09-16|

---

EP2650379A1|2013-10-16|

---

CA2694925C|2014-07-15|

---

KR101335021B1|2013-12-12|

---

PT2650382E|2016-01-14|

---

EP2650380A1|2013-10-16|

---

ES2608846T3|2017-04-17|

---

AU2008282130B2|2014-08-21|

---

PT2650380E|2016-01-14|

---

EP2650378A1|2013-10-16|

---

CA2694925A1|2009-02-05|

---

CA3078084A1|2009-02-05|

---

CA2853992C|2020-06-23|

---

EP2650382A1|2013-10-16|

---

ES2556535T3|2016-01-18|

---

EP2650382B9|2016-04-13|

---

EP2650381A1|2013-10-16|

---

EP2650379B1|2015-09-16|

---

PT2650381T|2016-12-29|

---

US9175345B2|2015-11-03|

---

EP2179284B1|2016-09-28|

---

EP2179284A4|2010-09-01|

---

EP2179284A2|2010-04-28|

---

WO2009018478A2|2009-02-05|

---

PT2650379E|2016-01-13|

---

ES2556536T3|2016-01-18|

---

PT2650378E|2016-01-14|

---

JP2010535037A|2010-11-18|

---

CN101809443A|2010-08-18|

---

AU2008282130A1|2009-02-05|

---

ES2556534T3|2016-01-18|

---

ES2608286T3|2017-04-07|

---

CN101809443B|2013-11-27|

---

US20110243885A1|2011-10-06|

---

PT2179284T|2016-12-30|

---

CA2853992A1|2009-02-05|

---

US10105338B2|2018-10-23|

---

WO2009018478A3|2009-03-12|

---

JP5819065B2|2015-11-18|

---

EP2650382B1|2015-09-16|

---

US20160030376A1|2016-02-04|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2766145A|1954-07-26|1956-10-09|Reynolds Tobacco Co R|Tobacco|

---

US2766146A|1954-07-26|1956-10-09|Reynolds Tobacco Co R|Tobacco|

---

US3053677A|1959-11-12|1962-09-11|Eastman Kodak Co|Petroleum wax for paper coatings|

---

US4112123A|1976-07-21|1978-09-05|Beatrice Foods Co.|Nutritionally balanced single food composition and method of production|

---

US4346107A|1979-02-12|1982-08-24|Claudio Cavazza|Pharmaceutical composition comprising acyl-carnitine for the treatment of impaired cerebral metabolism|

---

FR2490631B1|1980-09-24|1983-11-18|Roussel Uclaf|

---

US4528197A|1983-01-26|1985-07-09|Kabivitrum Ab|Controlled triglyceride nutrition for hypercatabolic mammals|

---

US4551523A|1983-04-14|1985-11-05|Eastman Kodak Company|Preparation of saccharide acetoacetates|

---

US4847296A|1984-09-13|1989-07-11|Babayan Vigen K|Triglyceride preparations for the prevention of catabolism|

---

US4687782A|1984-12-10|1987-08-18|Nutri-Fuels Systems, Inc.|Nutritional composition for enhancing skeletal muscle adaptation to exercise training|

---

JPH0829055B2|1986-09-12|1996-03-27|大塚製薬株式会社|Food composition|

---

US5126373A|1987-11-19|1992-06-30|Henri Brunengraber|Composition for parenteral and oral nutrition|

---

SE8803141L|1988-09-07|1990-03-08|Kabivitrum Ab|FOOD FOR FOOD AND ANIMALS|

---

JP2654812B2|1988-09-24|1997-09-17|コニカ株式会社|Curved silver halide photographic material|

---

US5118670A|1988-12-14|1992-06-02|Massachusetts Institute Of Technology|Process and composition for increasing brain dopamine release|

---

US5650148A|1988-12-15|1997-07-22|The Regents Of The University Of California|Method of grafting genetically modified cells to treat defects, disease or damage of the central nervous system|

---

DE3843238C1|1988-12-22|1990-02-22|Lohmann Therapie Syst Lts|

---

IT1240775B|1990-02-23|1993-12-17|Sigma Tau Ind Farmaceuti|ESTERS OF L-CARNITINE AND ACYL-L-CARNITINE WITH BETA-HYDROXYBUTIRRIC ACID AND PHARMACEUTICAL COMPOSITIONS THAT CONTAIN THEM FOR THE INHIBITION OF NEURONAL DEGENERATION, HEPATIC PROTEOLYSIS AND COMA TREATMENT.|

---

JP2735927B2|1990-03-26|1998-04-02|鐘紡株式会社|Neutral beverage in sealed container|

---

JP3226217B2|1990-04-26|2001-11-05|ザ、プロクター、エンド、ギャンブル、カンパニー|Shortening composition containing polyol fatty acid polyester|

---

US5538983A|1990-05-16|1996-07-23|The Rockefeller University|Method of treating amyloidosis by modulation of calcium|

---

US5385915A|1990-05-16|1995-01-31|The Rockefeller University|Treatment of amyloidosis associated with Alzheimer disease using modulators of protein phosphorylation|

---

US5175190A|1991-02-15|1992-12-29|The University Of British Columbia|Medium chain fatty acids of C8-10 for the treatment of skin lesions|

---

US5614560A|1991-04-04|1997-03-25|Children's Medical Center Corporation|Method of preventing NMDA receptor-mediated neuronal damage|

---

GB9113484D0|1991-06-21|1991-08-07|Unilever Plc|Cosmetic composition|

---

US5276059A|1992-07-10|1994-01-04|The United States Of America As Represented By The Department Of Health And Human Services|Inhibition of diseases associated with amyloid formation|

---

US5308832A|1992-07-27|1994-05-03|Abbott Laboratories|Nutritional product for persons having a neurological injury|

---

IL106877A|1992-09-10|1998-03-10|Lilly Co Eli|Rhodanine derivatives for use as medicaments for the treatment of alzheimer's disease|

---

EP0625212B1|1992-10-13|2004-03-24|Duke University|Methods of detecting alzheimer's disease|

---

US5494794A|1992-10-20|1996-02-27|Emory University|Detection of mitochondrial DNA mutations associated with Alzheimer's disease and Parkinson's disease|

---

JP3486778B2|1993-04-02|2004-01-13|三菱ウェルファーマ株式会社|Alzheimer's disease preventive / treatment agent|

---

JPH0725760A|1993-07-09|1995-01-27|Green Cross Corp:The|Agent for prevention and treatment of alzheimer's disease|

---

WO1995009144A1|1993-09-30|1995-04-06|Eastman Chemical Company|Nutritive water soluble glycerol esters of hydroxy butyric acid|

---

US5420335A|1993-09-30|1995-05-30|Birkhahn; Ronald H.|Parenteral nutrients based on watersoluble glycerol bisacetoacetates|

---

US5438042B1|1993-10-08|1997-08-26|Sandoz Nutrition Ltd|Enteral nutritional composition having amino acid profile|

---

JP3645580B2|1993-10-22|2005-05-11|株式会社フジモト・ブラザーズ|Brain metabolism improving agent containing glucose ester derivative|

---

US5691325A|1994-01-14|1997-11-25|Sandyk; Reuven|Method for ameliorating age-related disease conditions|

---

US6251928B1|1994-03-16|2001-06-26|Eli Lilly And Company|Treatment of alzheimer's disease employing inhibitors of cathepsin D|

---

US7049078B2|1994-04-27|2006-05-23|Judés Poirier|Apolipoprotein E polymorphism and treatment of alzheimer's disease|

---

GB9408465D0|1994-04-27|1994-06-22|Univ Mcgill|Apolipoprotein e polymorphism & treatment of alzheimer's disease|

---

US5607967A|1994-10-27|1997-03-04|Merck & Co., Inc.|Treatment of alzheimer's disease with 5--2-furan carboxylic acid|

---

ES2268696T3|1994-11-08|2007-03-16|Avicena Group, Inc.|USE OF CREATINE OR CREATINE ANALOGS FOR THE TREATMENT OF HUNTIGTON'S DISEASE, PARKINSON'S DISEASE AND AMIOTROPHIC SIDE STERHERISIS.|

---

US5817626A|1995-03-14|1998-10-06|Praecis Pharmaceuticals Incorporated|Modulators of beta-amyloid peptide aggregation|

---

JPH11514333A|1995-03-14|1999-12-07|プレーシスファーマスーティカルズインコーポレイテッド|Modulators of amyloid aggregation|

---

US5854215A|1995-03-14|1998-12-29|Praecis Pharmaceuticals Incorporated|Modulators of β-amyloid peptide aggregation|

---

JPH097785A|1995-06-26|1997-01-10|Mitsubishi Electric Corp|Discharge lamp lighting device|

---

AU6858696A|1995-08-24|1997-03-19|Advanced Nutritionals Corporation|Carbohydrate and medium chain triglyceride gel as an energy supplement|

---

US5635199A|1995-10-27|1997-06-03|Nestec Ltd.|Support of pediatric patients|

---

JP4598203B2|1995-12-01|2010-12-15|ビーティージー・インターナショナル・リミテッド|Brain function improver|

---

US5936078A|1995-12-12|1999-08-10|Kyowa Hakko Kogyo Co., Ltd.|DNA and protein for the diagnosis and treatment of Alzheimer's disease|

---

DE19609476A1|1996-03-11|1997-09-18|Basf Ag|Stable parenteral administration suitable carotenoid emulsions|

---

IT1284650B1|1996-05-24|1998-05-21|Sigma Tau Ind Farmaceuti|DRUG BASED ON A CARNITINE DERIVATIVE FOR THE TREATMENT OF ALZHEIMER'S DEMENTIA IN PATIENTS WITH EARLY ONSET OF THE PATHOLOGY|

---

KR980008239A|1996-07-26|1998-04-30|김충환|Cyclosporin-containing pharmaceutical composition|

---

US6022683A|1996-12-16|2000-02-08|Nova Molecular Inc.|Methods for assessing the prognosis of a patient with a neurodegenerative disease|

---

DE69838789T2|1997-03-12|2008-10-30|Suzanne Cambridge de la Monte|METHOD FOR TREATING OR PREVENTING ALZHEIMER'S DISEASE|

---

US20040058873A1|1998-03-12|2004-03-25|Esmond Robert W.|Method for treating or preventing Alzheimer's disease|

---

WO1998041201A1|1997-03-17|1998-09-24|Btg International Limited|Therapeutic compositions|

---

US6323237B1|1997-03-17|2001-11-27|Btg International Limited|Therapeutic compositions|

---

US6316038B1|1997-03-17|2001-11-13|Btg International Limited|Therapeutic compositions|

---

JPH1198952A|1997-09-29|1999-04-13|Fuji Oil Co Ltd|Food containing oil and fat and its production|

---

US6352722B1|1997-12-23|2002-03-05|Quadrant Holdings Cambridge Limited|Derivatized carbohydrates, compositions comprised thereof and methods of use thereof|

---

AU759467B2|1998-04-02|2003-04-17|Avicena Group, Inc.|Compositions containing a combination of a creatine compound and a second agent|

---

AU4573799A|1998-06-19|2000-01-05|Beth Israel Deaconess Medical Center|Dietary supplement for individuals under stress|

---

US6159942A|1998-06-19|2000-12-12|Bioenergy, Inc.|Compositions for increasing energy in vivo|

---

WO2000004895A2|1998-07-22|2000-02-03|Metabolix, Inc.|Nutritional and therapeutic uses of 3-hydroxyalkanoate oligomers|

---

US6395306B1|1998-09-14|2002-05-28|Pan Pacific Pharmaceuticals, Inc.|Bee venom protein and gene encoding same|

---

KR100805490B1|1998-09-15|2008-02-20|비티지 인터내셔널 리미티드|Therapeutic compositions ?|

---

GB9908202D0|1999-04-12|1999-06-02|Unilever Plc|Cosmetic compositions|

---

DK1292294T3|2000-05-01|2009-06-22|Accera Inc|Use of medium chain triglycerides for the treatment and prevention of Alzheimer's disease|

---

US20070179197A1|2000-05-01|2007-08-02|Accera, Inc.|Compositions and methods for improving or preserving brain function|

---

US6835750B1|2000-05-01|2004-12-28|Accera, Inc.|Use of medium chain triglycerides for the treatment and prevention of alzheimer's disease and other diseases resulting from reduced neuronal metabolism II|

---

DE20012857U1|2000-07-27|2000-11-09|Sportmedizin Team Vertriebs Gm|Dietary food for fat loss|

---

US6667397B2|2000-08-25|2003-12-23|Eastman Chemical Company|Methods of preparing disaccharide and trisaccharide C6-C12 fatty acid esters with high alpha content and materials therefrom|

---

GB2368011A|2000-10-17|2002-04-24|Unilever Plc|Fatty acid esters of maltose and uses thereof|

---

US20020103139A1|2000-12-01|2002-08-01|M. Weisspapir|Solid self-emulsifying controlled release drug delivery system composition for enhanced delivery of water insoluble phytosterols and other hydrophobic natural compounds for body weight and cholestrol level control|

---

JP2004517109A|2000-12-30|2004-06-10|エルジー ハウスホールド アンド ヘルスケア カンパニー．， リミテッド．|A skin lightening agent containing a glucose-acylated derivative or a sucrose-acylated derivative {Cosmeticforskinwhiteningcontainingacylsubstitutedderivativesofglucoseorsucrose}|

---

WO2002098398A1|2001-06-07|2002-12-12|Eisai Co., Ltd.|Methods for preventing and treating diseases and conditions associated with cellular stress|

---

JP2003048831A|2001-08-02|2003-02-21|Suntory Ltd|Composition having preventing and ameliorating action on symptom or disease caused by decrease in brain function|

---

AU2002336759A1|2001-09-21|2003-04-14|Accera, Inc.|Drug targets for alzheimer's disease and other diseases associated with decreased neuronal metabolism|

---

WO2003054143A2|2001-10-25|2003-07-03|Neurogenetics, Inc.|Genes and polymorphisms on chromosome 10 associated with alzheimer's disease and other neurodegenerative diseases|

---

GB0128510D0|2001-11-28|2002-01-23|Novartis Ag|Organic compounds|

---

BR0313588A|2002-08-07|2005-07-12|Novartis Ag|Methods for the treatment of apo and genotype-based dementia|

---

AU2003268235A1|2002-09-09|2004-03-29|Mitochroma Research, Inc.|Compositions and methods for treating niddm and other conditions and disorders associated with ampk regulation|

---

US6884454B2|2002-10-21|2005-04-26|Julio Lionel Pimentel|Appetite suppressing diet bar|

---

US20050031651A1|2002-12-24|2005-02-10|Francine Gervais|Therapeutic formulations for the treatment of beta-amyloid related diseases|

---

EP1605950A4|2003-03-06|2008-01-09|Accera Inc|Novel chemical entities and methods for their use in treatment of metabolic disorders|

---

US20060280721A1|2003-06-03|2006-12-14|The Gov Of Usa Represented By Secretary Of Dpt Of|Nutritional supplements and therapeutic compositions comprising -3- hydroxybutyrate derivatives|

---

US20050013884A1|2003-07-16|2005-01-20|Rennels M. Scott|Compositions and methods for treating heart disease|

---

US7148192B2|2004-01-29|2006-12-12|Ebwe Pharma Ges. M.H. Nfg.Kg|Neuroprotective dietary supplement|

---

US7939530B2|2004-05-30|2011-05-10|Sloan-Kettering Institute For Cancer Research|Treatment of lymphoma using 10-propargyl-10-deazaaminopterin and gemcitabine|

---

JP2006287138A|2005-04-05|2006-10-19|Mitsubishi Materials Corp|Lamination film for forming passive component, sheet type passive component, and its manufacturing method|

---

US20060252775A1|2005-05-03|2006-11-09|Henderson Samuel T|Methods for reducing levels of disease associated proteins|

---

US8227408B2|2005-09-07|2012-07-24|Neurotez, Inc.|Leptin as an anti-amyloidogenic biologic and methods for delaying the onset and reducing Alzheimer's disease-like pathology|

---

US20100144875A1|2005-12-15|2010-06-10|Larson Brian T|Compositions and Methods for Preserving Brain Function|

---

US20070173602A1|2006-01-25|2007-07-26|Brinkman Larry F|Encapsulated Michael addition catalyst|

---

PT2500017T|2006-04-03|2017-11-14|Accera Inc|Use of ketogenic compounds for treatment of age-associated memory impairment|

---

WO2008005818A1|2006-06-30|2008-01-10|Stepan Co|Glyceride esters for the treatment of diseases associated with reduced neuronal metabolism of glucose|

---

JP2008104359A|2006-10-23|2008-05-08|Dainippon Ink & Chem Inc|Carrier for immobilizing enzyme, immobilized enzyme and method for producing carrier for immobilizing enzyme|

---

PT2650380E|2007-07-31|2016-01-14|Accera Inc|Use of genomic testing and ketogenic compounds for treatment of reduced cognitive function|US6323237B1|1997-03-17|2001-11-27|Btg International Limited|Therapeutic compositions|

---

US6835750B1|2000-05-01|2004-12-28|Accera, Inc.|Use of medium chain triglycerides for the treatment and prevention of alzheimer's disease and other diseases resulting from reduced neuronal metabolism II|

---

EP1929995A1|2006-12-04|2008-06-11|INSERM |Anaplerotic therapy of Huntington disease and other polyglutamine diseases|

---

PT2650380E|2007-07-31|2016-01-14|Accera Inc|Use of genomic testing and ketogenic compounds for treatment of reduced cognitive function|

---

CA2729622C|2008-07-03|2017-07-25|Accera, Inc.|Monoglyceride of acetoacetate and derivatives for the treatment of neurological disorders|

---

US20110201558A1|2009-12-30|2011-08-18|Baylor Research Institute|Anaplerotic Therapy for Alzheimer's Disease and the Aging Brain|

---

EP2360280A1|2010-02-24|2011-08-24|Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol|Genetic marker for the diagnosis of dementia with Lewy bodies|

---

KR20150095704A|2012-12-13|2015-08-21|베일러 리서치 인스티튜트|Triheptanoin for the treatment of glucose transporter 1 deficiency|

---

US9833430B2|2013-11-14|2017-12-05|The University Of Queensland|Neurodegenerative disorders and methods of treatment and diagnosis thereof|

---

CN104305192B|2014-10-23|2016-05-04|贡岳松|Improve functional food of patients of senile dementia memory and preparation method thereof|

---

EP3626830A4|2017-05-15|2021-01-27|Infomeditech Co., Ltd.|Apoe promoter single nucleotide polymorphism associated with alzheimer's disease risk and use thereof|

---

CN109480284A|2018-12-05|2019-03-19|上海欣海生物科技有限公司|A kind of Ketogenic diet and preparation method thereof|

---

CN112903885A|2019-12-03|2021-06-04|中国科学院大连化学物理研究所|Application of combined metabolic marker for screening diabetes and kit thereof|

---

CN112226504B|2020-10-21|2021-06-08|北京市劳动保护科学研究所|Application of BuChE gene SNP locus and kit for analyzing and detecting susceptibility of anabasine pesticide contact population to high TG blood disease|

法律状态:

优先权:

---

申请号 | 申请日 | 专利标题

---

US95307407P| true| 2007-07-31|2007-07-31|

---

US953074P|2007-07-31|

---